Labshake search
Citations for Roche :
201 - 250 of 355 citations for L Leucine N T Boc H2O 13C6 97 99%; 15N 97 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: siRNAs and plasmids were transfected using DharmaFECT 1 transfection reagent (Dharmacon T-2001) and X-tremeGENE9 DNA transfection reagent (Roche 06365809001) respectively ...
-
bioRxiv - Bioengineering 2023Quote: ... lung tissues were thawed on ice and then resuspended in 0.5ml of Tissue Protein Extraction Reagent (T-PER) (ThermoScientific, cat# 78510) containing Complete Mini Protease Inhibitor Cocktail (Roche, cat# 11836170001). Tissues were homogenized using an electric handheld tissue homogenizer and were stored at -80°C until used for ELISA.
-
bioRxiv - Plant Biology 2023Quote: ... The membrane was washed with TBS-Tween 20 (TBS-T) and developed using freshly dissolved NBT/BCIP (NBT/BCIP Ready-to-Use Tablets, Roche, 11697471001) solution until the band appeared.
-
bioRxiv - Neuroscience 2024Quote: ... Tissues were washed three times with TBS-T and were incubated with a TUNEL reaction mixture (In Situ Cell Death Detection Kit, TMR red, Roche 12156792910) for 1 h at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... Southern blotting was carried out using Hybond-N+ membrane (Amersham) and DIG High Prime DNA Labeling and Detection Starter kit II (Roche), following the indications of the manufacturer ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Cell Biology 2020Quote: Cells were pelleted and lysed with 1.5% n-dodecyl-D-maltoside (DDM) in PBS with cOmplete™ protease inhibitor (Roche) for 15 min on ice ...
-
bioRxiv - Genetics 2021Quote: ... and Tvrm323 mice (n = 4) eyes at one month of age were dissected in ice- cold PBS with proteinase inhibitor (Roche) and snap frozen in eppendorf tubes on dry ice.
-
bioRxiv - Molecular Biology 2021Quote: ... lysate supernatant from cells expressing N-terminal 6-His-tagged proteins were incubated with nickel-nitrilotriacetic acid (Ni-NTA) cOmplete His-tag purification resin (Roche) for 1 h at 4° C ...
-
bioRxiv - Cell Biology 2019Quote: ... ground yeast powder was solubilized in 4 volumes of homogenization buffer (400 mM trisodium citrate, pH 8, 0.5% n-Dodecyl β-D-maltoside) and protease inhibitor cocktail (Roche). The soluble fraction was incubated with 10 μl magnetic beads (Dynabeads ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were seeded subconfluently o/n (unless indicated otherwise) onto coverslips acid-washed and coated with human fibronectin (25 μg/ml, #11051407001, Roche), as described (Dimchev and Rottner ...
-
bioRxiv - Immunology 2020Quote: ... The treated samples were purified using a C18 cartridge (Oasis HLB Plus Waters) prior to the release of N-glycans by PNGase F (recombinant from Escherichia coli, Roche) digestion ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were then washed with PBS and lysed in HEPES buffer supplemented 100 μM N-ethylmaleimide and protease inhibitor cocktail (Roche). The lysates were centrifuged and incubated with 2 μg Mcl-1 antibody (S-19 ...
-
bioRxiv - Immunology 2022Quote: ... and 11-week infected half brains and liver lobes of mice (n=4/group) was extracted and purified using a High Pure PCR Template Prep Kit (Roche). DNA concentration of each sample was determined via NanoDrop ...
-
bioRxiv - Neuroscience 2022Quote: cDNA was generated from TRAP-isolated and total input RNA samples (n=2 samples/group) using the Transcriptor First Strand cDNA Synthesis Kit (Roche) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... or HT alone and 0.001 μg/well N-terminally NL-tagged CCT5 and MAGEA3 (FL or -EE degrons) using X-tremeGene HP transfection reagent (Roche), following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... RPE1 cells were transfected with PB-Tet-LAP-MAP3K1 and PB-Transposase plasmid (kindly provided by N. Dimitrova) using X-tremeGENE9 reagent (Roche) and after 48 hours cells were selected with G418 ...
-
bioRxiv - Developmental Biology 2024Quote: ... were pre-washed in 0.25%BSA/DPBS and resuspended in 1ml of L3 sonication buffer (10mM TrisCl pH 8.0, 100mM NaCl, 1mM EDTA, 0.5mM EGTA, 0.1% Na-Deoxycholate, 0.5% N-Laroylsarcosine, filtered and with Roche Protease Inhibitor #04693159001) with 1% Triton ...
-
bioRxiv - Microbiology 2022Quote: ... Successful transformants were selected on YES agar plates containing 100 mg/L geneticin (Roche, #4727894001) and checked with colony PCR and sequencing ...
-
bioRxiv - Biochemistry 2023Quote: ... DNAse and cOmplete EDTA-free Protease Inhibitor Cocktail (Roche, 1 tablet/L initial culture volume) and lysed at 35,000 psi using a CF1 Cell Disruptor (Constant Systems) ...
-
bioRxiv - Neuroscience 2020Quote: Cells from mouse brain or spleen tissues were lysed with T-PER Tissue Protein Extraction Reagent (Thermo) containing Complete Protease Inhibitor Cocktail (Roche Applied Science). Protein concentrations were determined with BCA protein assay reagents (Pierce) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Initial T cell activation was performed with anti-CD3/anti-CD28 microbeads (T Cell TransAct, Miltenyi Biotech, 130-111-160) and 10µg/ml Phytohemagglutinin-M (PHA-M) (Roche 11082132001, 20 mg). Lentivirus transduction procedure ...
-
bioRxiv - Physiology 2023Quote: ... Protein extracts were prepared using T-PER (Pierce Chemical Co., IL) in the presence of protease inhibitors (Roche Applied Science, Barcelona, Spain), and subjected to Western blot analyses with anti-rat anti-ABCA1 antiserum (kindly donated by Dr ...
-
bioRxiv - Cell Biology 2019Quote: ... hypervirulent M.tb infected and uninfected macrophages using calibrated normalised relative quantities using the equation N = N0 x 2Cp (LightCycler®96 software, Roche). All qPCRs were done on RNA extracted from three separate experiments ...
-
bioRxiv - Developmental Biology 2021Quote: ... FISH signal was developed with tyramide reaction following O/N incubation of embryos in sheep anti-DIG antibody (Roche; Cat#11222089001) (1:1000 ...
-
bioRxiv - Immunology 2021Quote: ... incubated over-night (o/n) at 4°C with primary antibody diluted 1:500 in 5% Bovine Serum Albumin Fraction V (Roche 10735086001) in TBS-T ...
-
bioRxiv - Plant Biology 2022Quote: ... The products then transferred from the gel to Hybond N+ Nylon membrane (Amersham Biosciences) and detected using DIG Nucleic Acid Detection Kit (Roche Diagnostics) according to manufacturer’s protocol.
-
bioRxiv - Plant Biology 2022Quote: ... The products were then transferred from the gel to the Hybond N+ Nylon membrane (Amersham Biosciences) and detected using DIG Nucleic Acid Detection Kit (Roche Diagnostics), according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2023Quote: ... total RNA (50 μg) was separated on 1% agarose–formaldehyde gels and transferred to Hybond-N+ nylon membranes (Roche, Basel, Switzerland). Northern blotting was conducted with biotin-labeled DNA (bio-CTGTAGAAAGTCTGCTGATCGATACCGCGACG ...
-
bioRxiv - Neuroscience 2023Quote: ... prior to transfection with 2 μg pcDNA3.1 encoding N-terminally HA-tagged human 1N3R tau or 1N4R tau (14) using X-tremeGENE 9 (Roche Life Sciences), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... N-glycans were released directly using cartilage lysates following deglycosylation by overnight treatment with peptide N-glycanase F (PNGase F, 2U) (Roche, Switzerland). The supernatants containing GSLs and fOSs were dried with a centrifugal evaporator ...
-
bioRxiv - Microbiology 2024Quote: ... BHK cells were transfected with 3 μg of pBAC-SARS-COV-2 construct and1 μg of SARS-CoV-2 N (Delta) plasmid with the X-treme Gene 9 (X9) DNA transfection reagent (Roche: 6365809001) was added 1:3 as DNA:X9 ...
-
bioRxiv - Plant Biology 2021Quote: ... After 4 weeks of culture on MSD medium supplemented with 50 mg/L hygromycin (Roche, Germany), the resistant callus lines were transferred onto RM plates to generate transgenic rice seedlings ...
-
bioRxiv - Microbiology 2021Quote: ... Emulsion PCR was performed using the GS FLX Titanium emPCR Kit Lib-L (Roche Applied Science) to enrich DNA library beads for the 454 GS-junior sequencers ...
-
bioRxiv - Biophysics 2024Quote: ... 5% glycerol) per 1 L of cells with one EDTA-free protease inhibitor cocktail tablet (Roche). Cells were lysed using a Misonix Sonicator 3000 (110 W for 2 min total ON-time ...
-
bioRxiv - Genomics 2022Quote: ... All Mediator knock-out lines were verified as homozygous for the appropriate T-DNA insertion and transcript levels were quantified by RT-qPCR using a Roche 454 (Roche, Clifton NJ, USA) as described previously (Crawford et al. ...
-
bioRxiv - Developmental Biology 2023Quote: Probes for whole mount ISH and FISH were prepared with RT-PCR using primers listed in Table S7 followed by ligation into pGEM-T Easy vectors and transcribed using a DIG RNA labeling kit (Roche, Cat no. 11175025910), some probes were made using flourescein labeling mix (Roche ...
-
bioRxiv - Immunology 2023Quote: ... Initial T cell activation was performed using anti-CD3/anti-CD28 microbeads (T Cell TransAct, Miltenyi Biotech, 130-111-160) and 10 μg/mL Phytohemagglutinin-M (PHA-M) (Roche 11082132001, 20 mg). Lentiviral transduction was performed by inoculating cells with Vectofusin 1 (10 μg/mL ...
-
bioRxiv - Molecular Biology 2021Quote: ... were transiently transfected for 24 h with 9,36 μg of hNAA40-flag expression vectors and using 35 μl Fugene HD (Roche, cat. n°04709705001) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: We then targeted the N-(nucleoprotein) gene of SARS-CoV-2 virus with Roche Lightcycler 480 RNA Master Hydrolysis Probes (Roche Basel, Switzerland) with primers developed in house ...
-
bioRxiv - Cell Biology 2021Quote: Total protein from cells or mouse tissues (n=3 per genotype) were extracted using the M-PER protein lysis buffer (ThermoScientific, Beverly, MA) containing protease inhibitors (Roche, Indianapolis, IN). Approximately 25 μg of total protein was electrophoresed on 4-12% SDS-PAGE gels and transferred to PVDF membranes ...
-
bioRxiv - Physiology 2022Quote: ... n=3/genotype) were used for terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) to visualize cell apoptosis/death (Roche, Basel, Switzerland). Sections were counterstained with DAPI and visualized using epifluorescence (Nikon Eclipse Ni E800) ...
-
bioRxiv - Immunology 2022Quote: Anti-SARS-CoV-2 (N protein) IgM/IgG levels in the serum were measured using an Elecsys Anti-SARS-CoV-2 with cobas8000 (Roche Diagnostics KK) at the Department of Clinical Laboratory ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was extracted from the mPFC tissues of CamK2A-Cre;Gpr158fl/fl mice and the controls (n = 4) at the age of 8 weeks with Tripure Isolation Reagent (Roche, Mannheim, Germany). RNA-sequencing (RNA-seq ...
-
bioRxiv - Genetics 2022Quote: ... Embryos were then washed 3x 5 minutes in TBS-T (1% Tween-20 in Tris-buffered saline) and blocked for 1 hour in block solution (10% heat-inactivated sheep serum and 0.1% Roche blocking reagent in TBS-T). Roche blocking reagent was dissolved in maleic acid buffer according to manufacturer’s recommendations ...
-
bioRxiv - Immunology 2022Quote: ... Biotinylated human MIF was produced using D-biotinoyl- ε -aminocaproic acid-N-hydroxy-succinimide ester (Biotin-7-NHS) with the Biotin Protein Labeling Kit from Roche (Mannheim, Germany). Alternatively ...
-
bioRxiv - Cell Biology 2024Quote: ... We used the Agilent Bioanalyzer to assess the quality of the library and a qPCR approach with the KAPA Library Quantification Kit (Roche; P/N: KK4873) on the QuantStudio 12K device to quantify the library ...
-
bioRxiv - Cancer Biology 2021Quote: Each of experimental cell lines was harvested in a lysis buffer (0.5% SDS, 0.04 mol/L DTT, pH 7.5) containing the protease inhibitor EASYpacks (Roche, Germany). The lysates were denatured immediately at 100°C for 10 min ...
-
bioRxiv - Neuroscience 2021Quote: ... participants were given either a total of 225mg of L-DOPA (Madopar, Roche, Levodopa/Benserazid, 4:1 ratio) or a placebo (P-Tabletten white 8mm Lichtenstein ...
-
bioRxiv - Cell Biology 2021Quote: ... shTDP-43 HEK293E cell pellets from confluent 10cm plates were washed twice in ice-cold PBS and then resuspended in 500μl of hypotonic buffer A (10mM HEPES, 1.5mM MgCl2, 10mM KCl, 0.1mM DTT and protein inhibitor cocktail (Roche) and incubated on ice for 5 minutes ...