Labshake search
Citations for Roche :
451 - 500 of 509 citations for IL 8 CXCL8 Human 77a.a since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... and goat anti-human AF647 (Stratech 109-606-088- JIR)) DNA was then stained with DAPI (Roche) and coverslips mounted with Vectashield (Vector Laboratories - Vector H-1000).
-
bioRxiv - Immunology 2024Quote: Mice or Human CD4 T cells were lysed using RIPA buffer supplemented with protease inhibitor cocktail (Roche) and phosphatase inhibitors (Pierce) ...
-
bioRxiv - Genetics 2020Quote: ... 0.1 M ammonium bicarbonate, pH 8, 150 mM NaCl, 1 Roche mini protease inhibitor tablet without EDTA/10 ml, ½ Roche phosSTOP tablet/10 ml) using 14 × 1.5 min bursts on a BioSpec mini bead-beater at room temperature ...
-
bioRxiv - Genetics 2020Quote: ... The final linked-read library (8 cycles of PCR amplification) was quantified using the Kapa Library Quantification Kit (Cat. No. KK4824) from Kapa Biosystems (Woburn, MA, USA) and diluted to 4 nM ...
-
bioRxiv - Molecular Biology 2022Quote: ... Frozen cell pellets were re-suspended in lysis buffer (50 mM Tris-HCl, 500 mM NaCl, 10% glycerol, pH 8) containing protease inhibitors (Roche, complete mini, EDTA-free). Following lysis by sonication and centrifugation at 20,000 r.p.m ...
-
bioRxiv - Biochemistry 2023Quote: ... and were resuspended in 30 mL lysis buffer 1 (50 mM sodium phosphate, 300 mM NaCl, pH 8) containing 2 mL of EDTA-free protease inhibitor mixture (Roche Applied Science, Penzberg, Germany). Cells were disrupted by passing the cell suspension three times through a Constant Cell disruption system (TS benchtop ...
-
bioRxiv - Neuroscience 2023Quote: DRGs were collected from both WT and KO mice (8 weeks male) and were incubated in 1 mg/ml Collagenase/Dispase (Roche Diagnostics, Madison, WI, USA) at 37℃ for 60 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 8 μCi of α-32P-[ATP] and α-32P-[UTP] and 20 U of T7 RNA Polymerase or SP6 RNA Polymerase (Roche Applied Sicences). The reaction was incubated for 1 h at 37°C ...
-
bioRxiv - Genomics 2024Quote: Genomic DNA (5∼8 μg) for Nanopore sequencing was end-repaired and ligated via a KAPA Hyper Prep Kit (Cat#KR0961, Kapa Biosystems, Wilmington, MA, USA), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... resuspended in 150 μL buffer C (50 mM Tris pH 8, 5 mM EDTA, 1% SDS, 100 mM NaCl, 1x Roche complete mini protease inhibitors) and incubated on ice for 10 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Nuclei were pelleted at 800g for 10 min at 4°C and washed twice in buffer 1 and once in freezing buffer (1M Tris pH 8, 100% glycerol, 100mM MgAc2, 0.5M EDTA, 1M DTT, 1x PTase inhibitor cocktail Roche, 20U/µl SUPERase In Ambion). Nuclei were resuspended in freezing buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nuclear pellet was rinsed with 500 µL of resuspension buffer (20 mM Tris pH 8, 75 mM NaCl, 0.5 mM EDTA, 1 mM DTT, 0.125 mM PMSF, 50 % glycerol, 1x Roche complete, 20 U/mL RNase Out) and centrifuged at 4000 xg at 4°C for 3 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... and were then stained with the mouse monoclonal antibody against the human P16 protein (Ventana Roche-E6H4, USA) and the FITC-tagged secondary antibody ...
-
bioRxiv - Cell Biology 2021Quote: Human stem cells and neurons lysed with RIPA lysis buffer supplemented with 5mM EDTA and protease inhibitor (Roche), for 5 minutes at room temperature and 10 minutes on ice ...
-
bioRxiv - Immunology 2021Quote: ... freshly resected human samples were cut into small fragments and digested with 0.1 mg/ml Liberase TL (Roche) and 0.1 mg/ml DNase (Roche ...
-
bioRxiv - Developmental Biology 2021Quote: On day 0 (start of differentiation) human pluripotent stem cells were treated with 1mg/ml Collagenase B (Roche) for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... human vimentin immunohistochemical staining of the paraffin sections was performed by using the Ventana Discovery XT instrument (Roche) with Ventana DAB Map detection Kit (760-124 ...
-
bioRxiv - Biochemistry 2023Quote: ... The cells were then thawed and resuspended in 1 ml lysis buffer (50 mM Tris pH 8, 150 mM NaCl, 0.5 mg/ml lysozyme, 2 mM EDTA and one Roche protease inhibitor tablet per 10 ml). Complete lysis was achieved after a 15-min incubation at room temperature ...
-
bioRxiv - Neuroscience 2019Quote: ... barcoded and enriched using the NimbleGen SeqCap EZ Human Exome Library v2.0 enrichment kit (Roche NimbleGen, Madison, WI, USA). Purified and quantified library pool was subsequently sequenced on an Illumina HiSeq 2000 sequencing instrument (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... and human acute promyelocytic leukemia cell line NB4 (ATCC) were washed once with the digestion buffer for neuraminidase (Roche), the cells were centrifuged at 2000 rpm for 5 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 ng of nick translated probe per coverslip was combined with 12 μg of human Cot-1 DNA (Roche), 10 μg salmon sperm ssDNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... and NexCreERT2::R26R-tdT male mice received intraperitoneal injections (i.p.) of recombinant human (rh)EPO (5000 IU/kg body weight; NeoRecormon, Roche) or PL (solvent solution ...
-
bioRxiv - Neuroscience 2023Quote: Human induced pluripotent stem cell (iPSC) line KYOU-DXR0109B (ATCC) was routinely cultured on growth-factor reduced Matrigel (Roche) in mTeSR1 culture medium (StemCell Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: In vitro transcribed RNA was prepared from linearized plasmid containing the human PTH 3’-UTR (68) using a Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... kidney (human primary renal proximal tubule epithelial cells, RPTEC) and liver (human hepatocellular carcinoma, HepG2) cells were assessed using a standard WST-1 (Roche) cell viability assay ...
-
bioRxiv - Microbiology 2020Quote: Damage to the human colon epithelial cell line HT-29 was assessed using a lactate dehydrogenase (LDH) cytotoxicity detection kitPLUS (Roche), which measures the release of the LDH enzyme in the growth medium ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were seeded subconfluently o/n (unless indicated otherwise) onto coverslips acid-washed and coated with human fibronectin (25 μg/ml, #11051407001, Roche), as described (Dimchev and Rottner ...
-
bioRxiv - Cancer Biology 2022Quote: ... All embryonic histology slides and human tissue microarray (BioMax, U.S. #BC001134b) slides were scanned using a Ventana DP200 slide scanning system (Roche Diagnostics) at 20x magnification ...
-
bioRxiv - Biochemistry 2019Quote: ... and S278E amino acid substitutions were introduced into human RACK1 using the QuickChange II XL site-directed mutagenesis kit (Roche). All plasmids are available upon request.
-
bioRxiv - Synthetic Biology 2019Quote: ... and the candidates were PCR amplified from a U2OS (human bone osteosarcoma cell line) genome prep as template with the Kapa Hifi Hotstart Polymerase (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: A comprehensive list of coordinates of all the exonic and conserved regulatory elements from human X chromosome was used to design a customized capture library from Roche, NimbleGen (Supplementary Table 1) ...
-
bioRxiv - Cell Biology 2021Quote: Human pluripotent stem cells (hPSCs) were maintained in E8 medium and passaged every 4 days onto matrigel-coated plates (Roche). The following hPSC lines were used in the study ...
-
bioRxiv - Developmental Biology 2021Quote: H9 human pluripotent stem cells were maintained in E8 media and passaged every four days onto matrigel-coated plates (Roche). ESCs ...
-
bioRxiv - Cancer Biology 2022Quote: ... Between 50 and 100 ng of RNA was used as input for the KAPA RNA HyperPrep Kit with RiboErase (Human/Mouse/Rat) library preparation (Roche) on an automated liquid handling platform (Beckman Coulter) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... kidney (human primary renal proximal tubule epithelial cells, RPTEC), and liver (human hepatocellular carcinoma, HepG2) [45–50] cells were assessed using a standard WST-1 (Roche) cell viability assay ...
-
bioRxiv - Biochemistry 2023Quote: Cytotoxicity assays were performed as described29 (with minor changes. Proliferation of human cells was assessed using an MTT colorimetric assay (Cell Proliferation Kit I, Roche). HeLa (epithelial cells ...
-
bioRxiv - Immunology 2023Quote: K2 cells or human neutrophils were lysed with 150-200 µl of lysis buffer (supp. Table 2) supplemented with 1X complete inhibitor (Roche) and incubated for 10 min at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: Frozen brain tissues from human and animals were used to prepare 10% (w/v) homogenates in RIPA buffer containing PI and PhosStop (Roche). Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... To detect for DNA containing complementary sequences on membrane-bound DNA a α-32P-dCTP-labelled probe spanning the region of 37-611 nts on human mtDNA was synthesized using High Prime DNA Labeling Kit (Roche). After pre-hybridizing the membrane with Church’s buffer (250 mM NaPi pH 7.2 ...
-
bioRxiv - Immunology 2021Quote: ... PBMC were seeded at 1 × 106 cells/mL in erythroid differentiation-promoting medium based on StemSpan™ Serum-Free Expansion Medium (SFEM) supplemented with human recombinant EPO (2 U/ml, Roche), human recombinant stem cell factor (25 ng/ml ...
-
bioRxiv - Immunology 2022Quote: ... The normalization of DNA amount was performed by quantifying albumin gene copies with qPCR using human genomic DNA (20 ng/µl) standard (Roche, #11691112001) as we previously described16.
-
bioRxiv - Microbiology 2019Quote: ... while all other specific primers were designed to be compatible with the Human Universal Probe Library set (90 probes, octamer, Roche Diagnostics) (Supplementary Table 9 ...
-
bioRxiv - Immunology 2019Quote: ... the wells were washed five times and incubated with 100 µl/well goat anti-human IgG conjugated with alkaline phosphatase (Roche Diagnostics) diluted 1 in 5,000 for 30 min at 37 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... adapter-ligated libraries were prepared with the KAPA Hyper Prep Kit and sequencing libraries were constructed using SeqCap EZ Human Exome Library v3.0 (Roche, Basel, Switzerland). Cluster generation was performed with the HiSeq PE Cluster Kit v4 (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... then incubated for 30 min in Ringer solution before plating on fibronectin-coated glass coverslips (human plasma fibronectin at 10 µg/ml, Roche 10838039001).
-
bioRxiv - Microbiology 2021Quote: ... and washed once in cell lysis buffer supplemented with 20U of human placental RNase inhibitor and cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche) prior to processing lysates ...
-
bioRxiv - Microbiology 2021Quote: ... falciparum 3D7 or HEK 293F cells were suspended in 1× pellet volume of lysis buffer supplemented with 20U of human placental RNase inhibitor and cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche). Resuspended parasites were then transferred to a prechilled nitrogen cavitation chamber (Parr Instrument Company ...