Labshake search
Citations for Roche :
201 - 250 of 1261 citations for IL 3 Mouse HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Th17-cell differentiation was induced using a cytokine cocktail of IL-6 (20 ng/mL; Roche), IL-1β (10 ng/mL ...
-
bioRxiv - Immunology 2019Quote: For the in vitro cell stimulation and maintenance reagents were as follows: human IL-2 (Roche); IL-21 (PeproTech) ...
-
bioRxiv - Microbiology 2019Quote: ... Glutamax and Pen/Strep and with 100 U/mL recombinant human IL-2 (Roche; Sigma # 10799068001). For the analysis of reverse transcription products ...
-
bioRxiv - Immunology 2021Quote: ... in the absence (Th0) or presence (Th17) of IL-6 (20ng/ml, Roche, Cat# 11138600 001); IL-1β (10ng/ml ...
-
bioRxiv - Immunology 2021Quote: ... Th17 cell polarization was induced using a cytokine cocktail of IL-6 (20 ng/mL; Roche), IL-1β (10 ng/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... Infected cells were cultivated in the presence of IL-2 (10 IU/mL, Roche, Basel, Switzerland). Three days after coinfection cells were sorted based on expression of mouse CD48 and mCD24 (BD biosciences ...
-
bioRxiv - Microbiology 2023Quote: ... CD4+ T cells were cultured in RPMI + IL-2 (final concentration 100 U/mL, Roche, 10799068001), IL-7 (final conc ...
-
bioRxiv - Microbiology 2024Quote: ... interleukin-2 (IL-2; specific activity 10 U/ng) at concentration of 20 ng/mL (Roche) and phytohemagglutinin (PHA ...
-
bioRxiv - Immunology 2023Quote: ... the medium was supplemented with 30 IU/mL recombinant human interleukin 2 (IL-2) (Proleukin, Roche). Electroporated T cells were kept in culture ON and then used directly or frozen.
-
Trypanosoma brucei J protein 2 functionally cooperates with the cytosolic Hsp70.4 and Hsp70 proteinsbioRxiv - Molecular Biology 2019Quote: ... The resulting lysate was cleared by centrifugation (13 000 g, 40 min, 4°C) and the supernatant was incubated with cOmplete His-tag purification resin (Roche, Germany) and allowed to bind overnight at 4°C with gentle agitation ...
-
bioRxiv - Microbiology 2019Quote: ... mouse anti-GFP (Roche) (1:1000).
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-GFP (Roche), mouse anti-Ack1 (A-11 ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-GFP (Roche), anti-VSV-G 41A1 and rabbit anti-GM130 (clone EP892Y ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-GFP (Roche) 1:2000 ...
-
bioRxiv - Neuroscience 2022Quote: ... GFP (Mouse, Roche, 11814460001), GST (Mouse ...
-
bioRxiv - Genetics 2022Quote: ... from mouse (Roche #11814460001) antibody and Anti-Mouse IgG −Alkaline Phosphatase antibody (A9316 ...
-
bioRxiv - Plant Biology 2020Quote: ... mouse anti-GFP (Roche) 1:2500 ...
-
Single-cell RNA sequencing reveals distinct tumor microenvironmental patterns in lung adenocarcinomabioRxiv - Cancer Biology 2020Quote: ... mouse anti-p16 (Roche, #805-4713 ...
-
bioRxiv - Cell Biology 2022Quote: α-GFP (Roche, from mouse) 1:1000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... anti-GFP (Mouse, Roche) (1/500) ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 tablets of EDTA-free cOmplete inhibitor (Roche) were added to the media which was then centrifuged at 14,000 × g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 mg/ml Dispase II (Roche, Indianapolis, IN), and 1 mg/ml trypsin inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 tablets complete protease inhibitor EDTA free (Roche) and 1 tablet PhosSTOP (Roche) ...
-
bioRxiv - Genetics 2023Quote: ... and dithiothreitol (Roche; cat. no. 3483-12-3). Lysates were rocked at 4° C for 20 min and centrifuged for 10 min at 15,000 × g ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3) Complete protease inhibitor cocktail (Roche, cat #11836153001) was included for final 1X concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP phosphatase inhibitor Cocktail (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Microbiology 2024Quote: ... with buffer 3 or the Taq polymerase (Roche). The initial denaturation for Taq polymerase at 95 °C for 5 min was followed by 30 amplification cycles of 1 min at 95 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 mg/ml dispase II (Roche Diagnostics) in CMF Hank’s solution ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 U/ml dispase II (Roche Diagnostics, 4942078001), and 10 mM CaCl2 for 30 min at 37 °C with occasional shaking ...
-
bioRxiv - Biochemistry 2020Quote: ... and the presence of enzymes were confirmed by immunoblot using the anti-His6 antibody conjugated to peroxidase (BMG–His-1 monoclonal antibody) (Roche, Mannheim, Germany).
-
bioRxiv - Biophysics 2022Quote: ... and mixed with 1 mL Ni Sepharose 6Fast Flow (Cytiva, Tokyo Japan) (MinD) or cOmplete His-Tag Purification Resin (Roche, Basel, Switzerland) (MinE and msfGFP-MinC) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The quenched PFA solution was then removed and the tissue was resuspended in ice-cold Hi-C Lysis Buffer (10mM pH=8 Tris-HCl, 10mM NaCl, 0.2% NP-40 and 1x Roche Complete protease inhibitor). The lysis was helped with a Dounce Homogenizer Pestle A on ice (series of 10 strokes in 10’ intervals) ...
-
bioRxiv - Biochemistry 2023Quote: ... The soluble fraction of the cell lysate was transferred to a tube containing 30 μL cOMPLETE His-Tag purification Ni-NTA resin (Roche, Basel, Switzerland) suspended in 500 μL buffer A (8 M urea ...
-
bioRxiv - Systems Biology 2019Quote: ... The Th17 cultured cells were stimulated in presence of IL-6 (20ng/ml, Roche, Cat# 11138600 001); IL-1β (10ng/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 20 mM HEPES) supplied with 30 U/ml of human recombinant IL-2 (rIL-2, Roche). Four domains of SUPT16H ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were resuspended in complete media plus 10 IU/mL recombinant human IL-2 (rHIL-2, Roche), and seeded in fresh media at 0.5×106 cells/mL every 48 hours ...
-
bioRxiv - Immunology 2021Quote: ... plasma and LN cells were isolated in PBS containing a protease inhibitor cocktail (Roche Diagnostics, Chicago IL) and Ccl19/Ccl21 levels were determined by indirect sandwich of enzyme-linked immunosorbent assay (ELISA ...
-
bioRxiv - Cancer Biology 2020Quote: Cell pellets were homogenized in RIPA buffer (Pierce, Rockford, IL) with complete protease inhibitor (Roche, Basel, Switzerland). Insoluble material was removed by centrifugation at 16,000g at 4oC for 15mins ...
-
bioRxiv - Immunology 2023Quote: ... Serum IL-6 and CRP levels were measured using in vitro diagnostic methods validated at PPD (Roche Cobas ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the gRNA_enrichment1_fw (5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTGTG-GAAAGGACGAAACACCG-3’) and gRNA_enrichment1_rv (5’-CTACACGAC-GCTCTTCCGATCT-3’) primers and the 2x KAPA HiFi HotStart Ready Mix (Roche, Cat. No. KK2601). In a subsequent PCR ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...