Labshake search
Citations for Roche :
351 - 400 of 7243 citations for Human Single stranded DNA binding protein 4 SSBP4 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... sensors were moved into binding buffer with 1 mM GTP (Roche), 1 mM XTP (TriLink Biotechnologies) ...
-
bioRxiv - Genetics 2020Quote: ... and hybridized to human exome probes using the SeqCap EZ Prime Exome kit (Roche). The resulting exome libraries were sequenced with paired-end 150 bp Illumina reads on the HiSeq or NextSeq platforms at Admera Health (South Plainfield ...
-
bioRxiv - Immunology 2023Quote: ... Wells were pre-coated with 100 μL per well of capture anti-histone antibody contained in the Cell Death Detection ELISA kit (1:40 in 1x coating buffer; Roche 11544675001) or anti-myeloperoxidase (MPO ...
-
bioRxiv - Molecular Biology 2020Quote: ... and KAPA single-indexed adapter (Kapa Biosystems, KK8700) for Illumina platforms ...
-
bioRxiv - Immunology 2023Quote: ... and RealTime ready Single Assays (Roche, Basel, Switzerland) were used for CXCL10 (#100134759) ...
-
bioRxiv - Developmental Biology 2023Quote: ... KAPA-single index adapters (100 nM) (Roche, KK8702) were added to the A-tailed cDNA and the libraries underwent 10 cycles for amplification ...
-
bioRxiv - Developmental Biology 2024Quote: ... 7 µM KAPA-single index adapters (Roche, KK8700d) were added to A-tailed cDNA ...
-
bioRxiv - Developmental Biology 2024Quote: ... 100 nM KAPA-single index adapters (Roche, KK8700d) were added to A-tailed cDNA ...
-
bioRxiv - Cell Biology 2021Quote: Human pluripotent stem cells (hPSCs) were maintained in E8 medium and passaged every 4 days onto matrigel-coated plates (Roche). The following hPSC lines were used in the study ...
-
bioRxiv - Molecular Biology 2019Quote: ... Apoptosis was measured by Cell Death Detection ELISA (Roche). For reporter assays ...
-
bioRxiv - Cell Biology 2020Quote: ... The RNA-Seq Library was prepared according to KAPA Stranded mRNA-Seq poly(A) selected kits with 201-300 bp insert sizes (KAPA Biosystems, Wilmington, MA, USA) using 250 ng total RNA as an input ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 μg of RNA from each sample was processed using the KAPA Stranded mRNA-Seq Kit with mRNA capture beads (Kapa Biosystems, Bedford row, London). Each sample was then eluted in 20 μL of elution buffer adjusted to 10 mM ...
-
bioRxiv - Physiology 2023Quote: ... mRNA was enriched by poly-A capture and mRNA-seq libraries were generated using KAPA Stranded mRNA-seq Kit (KAPA Biosystems, Wilmington, Massachusetts, USA). For ovulated mature eggs ...
-
bioRxiv - Microbiology 2021Quote: ... and the MagNA Pure Compact DNA Isolation Kit I (Roche) following the protocol “Total_NA_Plasma_external_lysis purification protocol” ...
-
bioRxiv - Bioengineering 2022Quote: ... then complementary DNA was synthesized using a commercial kit (Roche) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... and libraries prepared using a DNA KAPA library kit (Roche) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... DNA was purified using High Pure PCR Purification Kit (Roche) and concentrations were quantified by Qubit (Thermo Scientific) ...
-
bioRxiv - Genomics 2022Quote: ... and adapter ligation using the KAPA HyperPrep DNA kit (Roche). Each ligation product was index-amplified using unique dual 8-bp indexing primers for eight cycles with KAPA HiFi polymerase (Roche).
-
bioRxiv - Molecular Biology 2023Quote: ... with FastStart Essential DNA Green Master kit (Roche; Rotkreuz, Switzerland) with ~3 ng of cDNA and three technical replicates ...
-
bioRxiv - Cancer Biology 2022Quote: ... For ligations using the Rapid DNA Ligation Kit (Roche 11635379001) vector and insert were mixed in a 1:3 molar ratio ...
-
bioRxiv - Microbiology 2023Quote: ... DNA libraries were prepared using a KAPA HyperPlus kit (Roche). Briefly ...
-
bioRxiv - Cancer Biology 2023Quote: ... with the KAPA hyper prep kit for DNA (now Roche). Truncated universal stub adapters were used for ligation ...
-
bioRxiv - Microbiology 2024Quote: ... the Fast Start Essential DNA Green Master qPCR Kit (Roche), and a LightCycler 96 instrument (Roche) ...
-
bioRxiv - Microbiology 2024Quote: ... using the LightCycler FastStart DNA Master HybProbe kit (Roche Diagnostics) supplemented with SYBR Green ...
-
bioRxiv - Microbiology 2019Quote: Chromosomal DNA was extracted from Ls cells with DNA Isolation Kit for Cells and Tissues (Roche, France). Plasmid DNA was extracted from E ...
-
bioRxiv - Cancer Biology 2021Quote: ... and DNA libraries were prepared using 50-200ng of genomic DNA with the KAPA HyperPrep kit (Roche). Protein-coding genes were captured using SureSelectXT Human All Exon V5 probes (Agilent ...
-
bioRxiv - Cell Biology 2022Quote: ... ChIP-seq DNA libraries were constructed using the KAPA HyperPlus DNA Library Prep Kit for Illumina (Roche) according to the manufacturer instructions ...
-
bioRxiv - Physiology 2019Quote: ... Libraries were constructed from purified DNA using the KAPA DNA Library Preparation Kit for Illumina (Kapa Biosystems). Input libraries were prepared from each experimental replicate using 10 ng of DNA purified immediately following shearing ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was extracted from formalin-fixed paraffin-embedded (FFPE) tissue (High Pure FFPET DNA Isolation Kit (Roche)) following laser capture microdissection in samples with small islands of malignant cells ...
-
bioRxiv - Pathology 2020Quote: ... RNA was extracted with the High Pure Kit Nucleic Acid Kit DNA-RNA (Roche Diagnostics) according to the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2020Quote: ... Double stranded cDNA was synthesised using the cDNA Synthesis System (Roche-Nimblegen), including RNase I and Proteinase K treatment followed by DNA clean up using the PCR purification kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and incubated with 4 μl of DIG-Prime kit (Roche, Mannheim, Germany), overnight at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Quantification of mcherry and gyrB (single gene copy on the plasmid and on the chromosomal DNA respectively) copy number was made from 25 pg of DNA using the LightCycler® FastStart DNA Master HybProbe kit (Roche, Bâle, Switzerland) following manufacturer’s instructions with appropriate oligonucleotides and Taqman probes (Table S1) ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse/rabbit IgG overnight at 4°C and further with protein G-coupled agarose beads (ROCHE) for 1-2 h ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... antibody binding was detected with the BCIP/NBT Color development system (Roche), using either anti-mouse or anti-rabbit alkaline phosphatase-conjugated antibodies (A3562 or A3687 ...
-
bioRxiv - Cell Biology 2023Quote: ... Binding reactions were performed in buffer A containing 2x protease inhibitor (Roche) for 1 hour at 4 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... was selected based on the levels of CAT expression which were determined in brain tissue homogenates of two-month old CAG-CAT-Prnp mice using the CAT ELISA kit (Roche, Basel, Switzerland) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The proliferative activities of VSMCs were quantified by BrdU incorporation using an enzyme-linked immunosorbent assay (ELISA) detecting kit (Roche, Mannheim, Germany) following the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were treated with dilutions of SB939 for 24 or 48 hours and cell proliferation was assessed using ELISA BrdU kit (Roche Diagnostics GmbH), according to manufacturer’s protocol.
-
bioRxiv - Cell Biology 2020Quote: ... 50 ng of nick translated probe per coverslip was combined with 12 μg of human Cot-1 DNA (Roche), 10 μg salmon sperm ssDNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Cell Biology 2020Quote: ... a DNA library was generated from 300 ng of genomic DNA using Kapa HyperPlus library preparation kit (Roche) according to manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Platforms included single end 454 GS FLX Titanium (Roche), single end Ion Torrent PGM (Personal Genome Machine) ...
-
bioRxiv - Genomics 2021Quote: ... KAPA single indexed adaptor set A (KAPA biosystems, KK8701) was used for adaptor ligation ...
-
bioRxiv - Cancer Biology 2024Quote: ... 100 nM of KAPA-single index adapters (Roche, KK8702) were added to the A-tailed cDNA and the libraries underwent 10 cycles of amplification ...
-
bioRxiv - Molecular Biology 2019Quote: ... and CAT expression was quantified using the CAT ELISA (Roche) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... and Cell Death ELISA (Roche, 11774425001, plasma dilution 1:2) which estimates cytoplasmic histone-associated DNA fragments (mono-and oligonucleosomes ...
-
bioRxiv - Biochemistry 2022Quote: ... Blocking Reagent for ELISA (BRE) (11112589001) was manufactured by Roche. 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC ...
-
bioRxiv - Biochemistry 2022Quote: ... Blocking reagent for ELISA (BRE, cat. 11112589001) was from Roche. DC Assay kit was from Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated for 15 minutes with 4 μL of X-treme Gene HP DNA transfection reagent (Roche). Transfected cells were selected for by hygromycin resistance ...