Labshake search
Citations for Roche :
501 - 550 of 844 citations for Human MXRA8 Mouse Fc Tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... FLAG-tagged proteins were detected with a mouse anti-FLAG (Roche) antibody diluted 1:1000 ...
-
bioRxiv - Plant Biology 2023Quote: ... Antibodies and titers used: 1:5,000 mouse anti-GFP (Roche 1814460001); 1:10,000 goat anti-mouse-HRP (Sigma A0168) ...
-
bioRxiv - Plant Biology 2024Quote: ... or mouse anti-Myc:HRP antibodies (9E10 clone, Roche [dilution 1:3000]), proteins were visualized using the Bio-Rad Clarity™ Western ECL kit and the ChemiDoc Imaging System (Biorad).
-
bioRxiv - Cell Biology 2024Quote: ... The following primary antibodies were used: mouse anti-GFP (#11814460001, Roche) rabbit anti-TACC (1:1000 ...
-
bioRxiv - Microbiology 2024Quote: ... Monoclonal mouse antibodies were used to detect GFP-tagged proteins (Roche) (dilution 1:2000 ...
-
bioRxiv - Cell Biology 2021Quote: Human stem cells and neurons lysed with RIPA lysis buffer supplemented with 5mM EDTA and protease inhibitor (Roche), for 5 minutes at room temperature and 10 minutes on ice ...
-
bioRxiv - Immunology 2021Quote: ... freshly resected human samples were cut into small fragments and digested with 0.1 mg/ml Liberase TL (Roche) and 0.1 mg/ml DNase (Roche ...
-
bioRxiv - Developmental Biology 2021Quote: On day 0 (start of differentiation) human pluripotent stem cells were treated with 1mg/ml Collagenase B (Roche) for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... human vimentin immunohistochemical staining of the paraffin sections was performed by using the Ventana Discovery XT instrument (Roche) with Ventana DAB Map detection Kit (760-124 ...
-
bioRxiv - Immunology 2021Quote: ... Culture media was supplemented with 500 U/mL human IL-2 (Tecin from Roche, kindly provided by the NIH) starting on culture day 2 ...
-
bioRxiv - Neuroscience 2019Quote: ... barcoded and enriched using the NimbleGen SeqCap EZ Human Exome Library v2.0 enrichment kit (Roche NimbleGen, Madison, WI, USA). Purified and quantified library pool was subsequently sequenced on an Illumina HiSeq 2000 sequencing instrument (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... and human acute promyelocytic leukemia cell line NB4 (ATCC) were washed once with the digestion buffer for neuraminidase (Roche), the cells were centrifuged at 2000 rpm for 5 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 ng of nick translated probe per coverslip was combined with 12 μg of human Cot-1 DNA (Roche), 10 μg salmon sperm ssDNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2023Quote: ... and NexCreERT2::R26R-tdT male mice received intraperitoneal injections (i.p.) of recombinant human (rh)EPO (5000 IU/kg body weight; NeoRecormon, Roche) or PL (solvent solution ...
-
bioRxiv - Neuroscience 2023Quote: Human induced pluripotent stem cell (iPSC) line KYOU-DXR0109B (ATCC) was routinely cultured on growth-factor reduced Matrigel (Roche) in mTeSR1 culture medium (StemCell Technologies ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Immunology 2024Quote: ... NK cells were cultured for the indicated amount of time with or without human IL-2 (TECINTM; teceleukin, ROCHE), human IL-15 (247-IL/CF ...
-
bioRxiv - Plant Biology 2020Quote: ... Western blotting was performed with mouse anti-GFP (1/1,000, Roche, 118144600001) and rabbit anti-ECH73 (1/1,000 ...
-
bioRxiv - Microbiology 2020Quote: ... Genotyping of mice was performed using a mouse genotyping kit (Kapa Biosystems). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-GFP (1:500; clones 7.1 and 13.1, Roche, cat. # 11814460001), rabbit anti-TgATG8 (1:500 ...
-
bioRxiv - Cell Biology 2020Quote: Antibodies used in this study included mouse monoclonal anti-GFP (Roche Diagnostics), rat anti-HA (Roche Diagnostics) ...
-
bioRxiv - Molecular Biology 2021Quote: ... All other antibodies were commercially available: mouse αGFP (Roche, 11814 460 001), rabbit αGFP rabbit (life technologies ...
-
bioRxiv - Developmental Biology 2020Quote: ... GFP and FLAG tagged proteins were visualized by mouse anti-GFP (Roche) and anti-FLAG M2 antibodies (Sigma ...
-
bioRxiv - Developmental Biology 2020Quote: Mouse islets were isolated by digesting the pancreas with collagenase P (Roche) and performing density gradient centrifugation as previously described [70] ...
-
bioRxiv - Microbiology 2021Quote: ... and Discovery OmniMap anti-mouse HRP (Roche Tissue Diagnostics cat# 760-4310). Slides were mounted using ProLong Diamond Antifade mountant w/ DAPI (Invitrogen cat# P36971).
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-GFP (1:500; clones 7.1 and 13.1, Roche, cat. # 11814460001), mouse MAb 45.56 anti-TgIMC1 (1:500 ...
-
bioRxiv - Molecular Biology 2022Quote: Antisera used: 1:200 mouse anti-GFP clones 7.1 and 13.1 (Roche), 1:500 rat anti-HA clone 3F10 (Roche) ...
-
bioRxiv - Cell Biology 2022Quote: ... The mouse monoclonal anti-GFP antibody is a commercial product from Roche (lot #11814460001 ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were immunostained with mouse anti-GFP (1:250 dilution; Roche, 11814460001), rabbit anti-Aldolase-HRP conjugated (1:5000 dilution ...
-
bioRxiv - Plant Biology 2021Quote: ... and LHCB3 were immunochemically detected with mouse anti-GFP (1:10,000; Roche), rabbit anti-LHCB1 (1:5,000 ...
-
bioRxiv - Cell Biology 2020Quote: ... Anti-GFP (mouse; 11814460001; clones 7.1 and 13.1 mix; Roche, Basel, Switzerland) antibody was used to detect the TC10 biosensor or fluorescently tagged TC10 protein.
-
bioRxiv - Microbiology 2019Quote: PLA and ISH-PLA were carried out using mouse anti-digoxin (Roche) and rabbit anti-Flag (Sigma-Aldrich) ...
-
bioRxiv - Plant Biology 2021Quote: ... Myc-tagged proteins were detected using anti-myc antibody (mouse monoclonal; Roche) di-luted 1:5000 (v/v) ...
-
bioRxiv - Cell Biology 2019Quote: ... 1° antibodies used: α-GFP 1:1000 dilution (Mouse, Roche, Cat.No. 11814460001), α-Tubulin (TAT1 ...
-
bioRxiv - Cell Biology 2019Quote: ... Splenocytes were fused with PAI mouse myeloma cells using polyethylene glycol (Roche). Hybridoma supernatants were screened by indirect ELISA with His-tagged Sec23A as the antigens ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were detected using monoclonal anti‐GFP (mouse; 1:3000; Roche 11814460001). Secondary antibody was HRP‐linked anti‐mouse polyclonal (goat ...
-
bioRxiv - Physiology 2021Quote: ... midguts were incubated with 1:500 anti-GFP (mouse) antibody (Roche #11814460001) for 3h ...
-
bioRxiv - Cell Biology 2022Quote: ... was coupled to 1 μg monoclonal mouse anti-GFP antibody (#11814460001, Roche) and incubated with protein extracts ...
-
bioRxiv - Cell Biology 2022Quote: ... Other primary antibodies used for immunoblotting include mouse anti-GFP (Roche, 1814460) and rabbit anti-myc (Cell Signaling ...
-
bioRxiv - Cell Biology 2022Quote: ... Beads were incubated with 3.5 μg mouse anti-GFP antibody (11814460001, Roche) for a minimum of 10 min on room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... as loading control and incubated with a mouse α-GFP antibody (Roche). An HRP-coupled goat α-mouse antibody (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... Antibodies for western blotting were diluted as follows: mouse anti-GFP (Roche) 1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by incubation in mouse anti-BrdU (1:400, Roche, Basal, Switzerland), goat anti-DCX (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: Mouse DRG tissues were dissociated with 1 mg/ml Collagenase/Dispase (Roche) in a shaking incubator for 90 min ...
-
bioRxiv - Microbiology 2023Quote: ... Genotyping of mice was performed using a mouse genotyping kit (Kapa Biosystems). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: In vitro transcribed RNA was prepared from linearized plasmid containing the human PTH 3’-UTR (68) using a Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... kidney (human primary renal proximal tubule epithelial cells, RPTEC) and liver (human hepatocellular carcinoma, HepG2) cells were assessed using a standard WST-1 (Roche) cell viability assay ...