Labshake search
Citations for Roche :
251 - 300 of 431 citations for Human GSDMC shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... and NexCreERT2::R26R-tdT male mice received intraperitoneal injections (i.p.) of recombinant human (rh)EPO (5000 IU/kg body weight; NeoRecormon, Roche) or PL (solvent solution ...
-
bioRxiv - Neuroscience 2023Quote: Human induced pluripotent stem cell (iPSC) line KYOU-DXR0109B (ATCC) was routinely cultured on growth-factor reduced Matrigel (Roche) in mTeSR1 culture medium (StemCell Technologies ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Immunology 2024Quote: ... NK cells were cultured for the indicated amount of time with or without human IL-2 (TECINTM; teceleukin, ROCHE), human IL-15 (247-IL/CF ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were then transfected with the respective plasmids using X- tremeGENE™ HP DNA transfection reagent (Roche, #6365779001) for 48 h (24 h for Toca-1 and Cdc42).
-
bioRxiv - Developmental Biology 2021Quote: ... Sense and antisense RNA probes were transcribed from linearized plasmid DNA using a DIG RNA Labeling Kit (Roche). Sections were prepared by embedding hybridized embryos in gelatin-albumin and sectioning on a vibratome (Leica VT1000S ...
-
bioRxiv - Cell Biology 2022Quote: ... All siRNA were transfected or co-transfected with emerin plasmids at 25 nM using X-tremeGENE HP (Roche). When associated with lentiviral expression of emerin ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with siRNAs or plasmid DNAs using Dharmafect 4 (Dharmacon) or Fugene 6 (Roche Applied Sciences) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: pLKO.1 lentiviral construct along with packaging vector ΔVPR and VSVG plasmids were transfected using Fugene-6 (Roche) or PEI (POLYSCIENCES 23966-2 ...
-
bioRxiv - Molecular Biology 2021Quote: Stable integrants of pcDNA5/FRT/TO plasmids were established by cotransfection with pOG44 by X-tremeGENE9 (Roche, 06365787001) and selected with blasticidin S (InvivoGen ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmid and siRNA transfection into HeLa cells were carried out using X-tremeGENE 9 DNA transfection reagent (Roche) and Oligofectamine reagent (Invitrogen) ...
-
bioRxiv - Molecular Biology 2019Quote: ... A plasmid (25 ng reporter, 100 ng effector) was transfected with 0.4 μl FuGENE HD (Roche, Basel, Switzerland) per well at a cell confluence level of 50-70% ...
-
bioRxiv - Cancer Biology 2019Quote: ... The three SCC cell lines were transiently transfected with the expression plasmids using FuGENE HD transfection reagent (Roche Molecular Systems ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plasmid was linearized and an in vitro transcription reaction with DIG labeling mix (Roche, cat. no. 1277073) was performed as previously described [18] ...
-
bioRxiv - Developmental Biology 2019Quote: ... Afterwards, plasmids were linearized (in case of T7-VP16, T7-eng, or T7) and in vitro transcribed (Roche). The EomesA-VP16 plasmid (containing 153aa-431aa of the zebrafish EomesA ORF ...
-
bioRxiv - Immunology 2021Quote: ... HA-flanked transgenes were amplified from the plasmids by PCR using the KAPA HiFi HotStart 2x Readymix (Roche) with reaction volumes > 500 µl ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid constructs used in this study (Table S3) were generated by cloning PCR products (Kapa Hifi Polymerase, Roche) obtained with oligonucleotide primers listed in Table S4 and digested with the indicated restriction enzymes (New England Biolabs) ...
-
bioRxiv - Genetics 2023Quote: ... was amplified from the Tad2-containing pSG-thrC-Phspank plasmid using KAPA HiFi HotStart ReadyMix (Roche, cat #KK2601) with the primer pair tad2KIF and tad2KIr (Supplementary table 15) ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were transfected with 1 µg/mL plasmid DNA using Fugene HD transfection reagent (Roche Diagnostics, Indianapolis, IN).
-
bioRxiv - Biochemistry 2023Quote: ... pCW57.1_yeastAOX 32 with the Delta-Vpr packaging plasmids and the VSV-G envelope plasmid (DNA concentration ratio, 1.2: 1: 0.3) into HEK293T cells using X-tremeGENE 9 Transfection Reagent (Roche). Lentivirus-containing media was harvested at 24 hr after fresh media change ...
-
bioRxiv - Neuroscience 2023Quote: ... Vectors were co-transfected with packaging-defective helper plasmids into 293T cells using Fugene 6 transfection reagent (Roche). Fibroblasts were plated at a density of 50,000 cells/well on 0.1% gelatin-coated 6-well plates and infected three times with a viral cocktail containing vectors expressing OCT4:SOX2:KLF4:cMYC in a 2:1:1:1 ratio in the presence of 6 µg/ml protamine sulfate (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... and DIG-UTP labelled cRNA probes synthetized from linearized plasmids using either SP6 or T7 RNA polymerases (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: In vitro transcription was performed incubating 1 μg of linearized plasmids with 1x transcription buffer (Roche Applied Science), 10 mM DTT ...
-
bioRxiv - Molecular Biology 2024Quote: Site directed mutagenesis of plasmids listed in Table 1 was carried out using KAPA HiFi HotStart premix (Roche) or Tks Gflex DNA polymerase (Takara Bio ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... kidney (human primary renal proximal tubule epithelial cells, RPTEC) and liver (human hepatocellular carcinoma, HepG2) cells were assessed using a standard WST-1 (Roche) cell viability assay ...
-
bioRxiv - Microbiology 2020Quote: Damage to the human colon epithelial cell line HT-29 was assessed using a lactate dehydrogenase (LDH) cytotoxicity detection kitPLUS (Roche), which measures the release of the LDH enzyme in the growth medium ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were seeded subconfluently o/n (unless indicated otherwise) onto coverslips acid-washed and coated with human fibronectin (25 μg/ml, #11051407001, Roche), as described (Dimchev and Rottner ...
-
bioRxiv - Cancer Biology 2022Quote: ... All embryonic histology slides and human tissue microarray (BioMax, U.S. #BC001134b) slides were scanned using a Ventana DP200 slide scanning system (Roche Diagnostics) at 20x magnification ...
-
bioRxiv - Biochemistry 2019Quote: ... and S278E amino acid substitutions were introduced into human RACK1 using the QuickChange II XL site-directed mutagenesis kit (Roche). All plasmids are available upon request.
-
bioRxiv - Synthetic Biology 2019Quote: ... and the candidates were PCR amplified from a U2OS (human bone osteosarcoma cell line) genome prep as template with the Kapa Hifi Hotstart Polymerase (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: A comprehensive list of coordinates of all the exonic and conserved regulatory elements from human X chromosome was used to design a customized capture library from Roche, NimbleGen (Supplementary Table 1) ...
-
bioRxiv - Cell Biology 2021Quote: Human pluripotent stem cells (hPSCs) were maintained in E8 medium and passaged every 4 days onto matrigel-coated plates (Roche). The following hPSC lines were used in the study ...
-
bioRxiv - Developmental Biology 2021Quote: H9 human pluripotent stem cells were maintained in E8 media and passaged every four days onto matrigel-coated plates (Roche). ESCs ...
-
bioRxiv - Cancer Biology 2022Quote: ... Between 50 and 100 ng of RNA was used as input for the KAPA RNA HyperPrep Kit with RiboErase (Human/Mouse/Rat) library preparation (Roche) on an automated liquid handling platform (Beckman Coulter) ...
-
bioRxiv - Cell Biology 2023Quote: ... CD4+ T-cells were plated in 200ul of medium (RPMI, 10% human serum) containing IL-2 (Roche, 10 IU/mL) and IL-7 (Peprotech ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... kidney (human primary renal proximal tubule epithelial cells, RPTEC), and liver (human hepatocellular carcinoma, HepG2) [45–50] cells were assessed using a standard WST-1 (Roche) cell viability assay ...
-
bioRxiv - Immunology 2023Quote: K2 cells or human neutrophils were lysed with 150-200 µl of lysis buffer (supp. Table 2) supplemented with 1X complete inhibitor (Roche) and incubated for 10 min at 4 °C ...
-
bioRxiv - Biochemistry 2023Quote: Cytotoxicity assays were performed as described29 (with minor changes. Proliferation of human cells was assessed using an MTT colorimetric assay (Cell Proliferation Kit I, Roche). HeLa (epithelial cells ...
-
bioRxiv - Neuroscience 2023Quote: Frozen brain tissues from human and animals were used to prepare 10% (w/v) homogenates in RIPA buffer containing PI and PhosStop (Roche). Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... To detect for DNA containing complementary sequences on membrane-bound DNA a α-32P-dCTP-labelled probe spanning the region of 37-611 nts on human mtDNA was synthesized using High Prime DNA Labeling Kit (Roche). After pre-hybridizing the membrane with Church’s buffer (250 mM NaPi pH 7.2 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Neural stem / progenitor cells were seeded in coated 24-well plates (1.6×105 cells per well) and transfected with the reporter plasmids using xTremeGENE HP DNA transfection reagent (Roche). Cells were collected 48hr after transfection using Passive lysis buffer (Promega) ...
-
bioRxiv - Cell Biology 2019Quote: ... and packaging plasmids PEx-QV and pMD-G were co-transfected into HEK 293T cells using Fugene 6 (Roche). After 4 days ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmids and ssDNA were transfected into hESC_H1 (WiCell) of 70-85% confluency using the XtremeGENE 9 transfection reagent (Roche). After 48 hours ...
-
bioRxiv - Microbiology 2022Quote: ... Two µg plasmid DNA and 25 µL DOTAP (N-[1-(2,3- Dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate) (Roche Diagnostics Deutschland GmbH ...
-
bioRxiv - Cell Biology 2022Quote: ... were transfected with 200 ng of plasmids for 48 h using X-tremeGENE 9 DNA reagent (Roche, Fig. 2A), or electroporated with 2 μg of plasmid using Lonza’s nucleofection protocol (Fig ...
-
bioRxiv - Cell Biology 2022Quote: ... S3C) or 120 ng of plasmid for 24h (Fig. 3E) for 24h using X- tremeGENE 9 DNA reagent (Roche).
-
bioRxiv - Cancer Biology 2022Quote: ... DF1 cells were transfected with the indicated RCAS plasmid using X-tremeGENE 9 DNA transfection reagent (Roche, Catalog# 06365809001) according to the manufacturer’s protocol ...