Labshake search
Citations for Roche :
251 - 300 of 10000+ citations for Human Fibrinogen C Domain Containing Protein 1 FIBCD1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... and 1% TX-100) containing Protease Inhibitor Cocktail (Roche, Basel, Switzerland), and the lysates were then centrifuged at 20,000 g for 10 min at 4°C to remove debris ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % NP-40) containing with the cOmplete protease inhibitor cocktail (Roche) and PhosSTOP (Roche) ...
-
bioRxiv - Cell Biology 2024Quote: ... resuspended in 1 ml vPBS containing EDTA-free protease inhibitor (Roche) and – for widefield microscopy - attached to the poly-L-lysine-coated coverslips by centrifugation (750 x g ...
-
bioRxiv - Immunology 2023Quote: ... containing 1 mg/ml Liberase TL Research Grade (Roche, cat. 5401020001) and 30 U/ml DNase I (Qiagen ...
-
bioRxiv - Plant Biology 2023Quote: ... 1/200 mM NaF) containing 4 tablets of protease inhibitor (Roche cOmplete ...
-
bioRxiv - Developmental Biology 2024Quote: ... blocked with MABT/Block (MABT containing 1% blocking reagent (Roche #11096176001)) for 1 h at RT ...
-
bioRxiv - Cancer Biology 2021Quote: ... and cell suspensions incubated for 10 min at 4°C in SDS lysis buffer containing protease inhibitors (Complete protease inhibitor cocktail, Roche). The remaining procedures were performed as described in previous reports (Carvajal-Gonzalez et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... and age-matched controls lacking evident tau pathology were gently homogenized at 4°C in 10 mL of TBS buffer containing protease inhibitor cocktails (Roche) using a dounce homogenizer ...
-
bioRxiv - Immunology 2020Quote: ... intestines were further chopped and incubated for 30 min at 37°C in medium containing liberase (20 µg/ml, Roche) and DNAse (400 µg/ml ...
-
bioRxiv - Immunology 2022Quote: ... Tissue was incubated at 37°C for 15 minutes in FBS free DMEM media containing Liberase™ TL (0.25mg/ml; Roche) and DNAse I (0.5mg/ml ...
-
bioRxiv - Immunology 2022Quote: ... Tissue was incubated at 37°C for 30 minutes in FBS free DMEM media containing Liberase™ TL (0.25mg/ml; Roche) and DNAse I (0.5mg/ml ...
-
bioRxiv - Immunology 2022Quote: ... tumor tissue was incubated at 37°C for 30minutes in FBS free DMEM media containing liberase™ TL (0.25mg/ml; Roche) and DNAse I (0.5mg/ml ...
-
bioRxiv - Immunology 2022Quote: ... frozen tissue fragments were thawed and incubated for 5 minutes at 37°C in a dissociation buffer containing RPMI-1640 supplemented with 10 U/mL DNase (Roche), 200 U/mL collagenase IV (Worthington Biochemical) ...
-
bioRxiv - Cell Biology 2024Quote: ... The cells were pelleted by centrifugation (750 x g, 2 min, 4 °C) and resuspended in 50 μl vPBS containing EDTA-free protease inhibitor (Roche). The cells were fixed by addition of 0.5 ml ice-cold fixation solution (4% (v/v ...
-
bioRxiv - Microbiology 2020Quote: Proteins from various cells were extracted with 1x RIPA buffer containing 1x complete-mini protease inhibitor (Roche; #11836170001) and 1x phosphatase inhibitor cocktail (Roche ...
-
bioRxiv - Neuroscience 2020Quote: Total proteins were extracted from mouse striata in PBS containing 0.1% Tween 20 and Protease Inhibitor cocktail (Roche) with or without 1 mM non-hydrolysable ADP (Sigma) ...
-
bioRxiv - Microbiology 2020Quote: Protein was extracted from cells in Radioimmunoprecipitation assay (RIPA) lysis buffer containing 1X Complete Protease Inhibitor Cocktail (Roche) and 1X Phenylmethylsulfonyl fluoride (Sigma Aldrich ...
-
bioRxiv - Immunology 2019Quote: ... These cells were then lysed in T-PER tissue protein extraction reagent (Pierce) containing protease inhibitor cocktail (Roche) and phosphatase inhibitor cocktail 1(Sigma) ...
-
bioRxiv - Microbiology 2020Quote: Protein was extracted from cells in Radioimmunoprecipitation assay (RIPA) lysis buffer containing 1X Complete Protease Inhibitor Cocktail (Roche) and 1X Phenylmethylsulfonyl fluoride (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: Total proteins were extracted in RIPA buffer (Cat. #89901, Pierce) containing complete protease inhibitor cocktails (Cat. #04693116001, Roche) and phosSTOP (Cat ...
-
bioRxiv - Immunology 2020Quote: ... cultured in vitro at 30 °C and at 37 °C in EMJH medium was also extracted using a High Pure RNA Isolation kit (Roche Applied Science) following the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2021Quote: ... The Hi-C library was quantified using a KAPA library quantification kit (Roche), and further PCR amplification was performed using Phusion Hot Start II DNA polymerase (Thermo Scientific) ...
-
bioRxiv - Immunology 2019Quote: ... and subjected to 1 hour treatment with bacterial sialidase C (Roche) at 37C ...
-
bioRxiv - Neuroscience 2020Quote: ... at 4°C with alkaline phosphate anti-DIG (1:2000, Roche). For chromogenic revelation ...
-
bioRxiv - Developmental Biology 2019Quote: ... 1/10 volume of Protein-G agarose beads (Roche) was then added and the sample rotated for 30 min at RT °C ...
-
bioRxiv - Neuroscience 2021Quote: ... was selected based on the levels of CAT expression which were determined in brain tissue homogenates of two-month old CAG-CAT-Prnp mice using the CAT ELISA kit (Roche, Basel, Switzerland) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The proliferative activities of VSMCs were quantified by BrdU incorporation using an enzyme-linked immunosorbent assay (ELISA) detecting kit (Roche, Mannheim, Germany) following the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were treated with dilutions of SB939 for 24 or 48 hours and cell proliferation was assessed using ELISA BrdU kit (Roche Diagnostics GmbH), according to manufacturer’s protocol.
-
bioRxiv - Genetics 2021Quote: ... Capture-C libraries were made using the Arima HiC kit (Arima Genomics) and the KAPA HyperPrep kit (KAPA Biosystems) following the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Endogenous peroxidase activity was blocked by incubation with 3% H2O2 for ten minutes followed by two washes with PBS containing 0.1% Tween-20 and blocking with PBS containing 1% bovine serum albumin (Roche, Mannheim, Germany) and 0.2% skim milk powder (Easis ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mM DTT and 1 mM EDTA) containing EDTA-free protease inhibitor cocktail (mini-complete, Roche), 20 μM MG132 and 25 μg/ml ALLN followed by boiling in SDS sample buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1 mM dithiothreitol) containing 1% Triton X-100 and protease and phosphatase inhibitor cocktails (Roche) (HS-TX buffer ...
-
bioRxiv - Developmental Biology 2019Quote: ... 1% deoxycholic acid and 1% Nonidet P-40 [NP-40]) containing protease inhibitor cocktail (Roche Diagnostics) and placed on ice for 30 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... resuspension in 1 volume of TBS containing 1 mM PMSF and cOmplete protease inhibitor cocktail (Roche), and dropwise addition to liquid nitrogen to snap freeze ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were harvested and incubated in buffer A (50 mM MMT pH 8.0/300 mM KCl/10 mM MgCl2/5 % glycerol) containing 1 g L-1 lysozyme/2.5 U mL-1/SmDNAse//complete protease inhibitor cocktail (Roche) for 1 h prior to lysis using EmulsiFlex C5 (Avestin ...
-
bioRxiv - Immunology 2022Quote: The dorsal halves of the ear skin of mice were collected and incubated for 70 min at 37°C in cRPMI containing 0.33 mg/ml Liberase TL (Roche, Basel, Switzerland) and 0.05% DNase I (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... incubated overnight at 32°C and replica-plated on a YES agar plate containing 100 mg/L hygromycin B (Roche, #10843555001). The hygromycin plates were incubated for 1-2 days at 32°C until colonies had formed ...
-
bioRxiv - Molecular Biology 2023Quote: ... and CBD patients were gently homogenized at 4 °C in 5 mL of TBS buffer containing one tablet of cOmplete™ mini EDTA-free protease inhibitor cocktail (Roche) at a concentration of 20% w/vol using a Dounce homogenizer ...
-
bioRxiv - Neuroscience 2023Quote: ... Each brain with known weight was homogenized at 4°C using automated homogenizer and with IX RIPA buffer containing protease inhibitor tablet (Roche, Germany). After that the brain lysates were centrifuged at 12,000 rpm for 10 mins ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were lysed on ice with kit lysis buffer containing protease inhibitor tablets (Roche), scraped into pre-chilled tubes and incubated on ice for 30 minutes with intermittent vortexing ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% Penicillin/Streptomycin and 20 IU human IL-2 (Roche Diagnostics, Mannheim, Germany) for 5d ...
-
bioRxiv - Molecular Biology 2020Quote: 5 μl of antiserum were diluted with 250 μL of PBS containing 0.05% NP-40 and coupled to 10 μl of Protein A-Agarose beads (Roche) by rotating at 4°C overnight ...
-
bioRxiv - Genomics 2020Quote: ... Protein lysates were prepared by manually homogenizing frozen tissue in RIPA buffer containing protease and phosphatase inhibitor cocktails (Roche). Proteins were separated on a 4-20% TGX SDS-PAGE gel (Bio-Rad ...
-
bioRxiv - Neuroscience 2020Quote: Proteins were extracted using Tris-buffered Saline (TBS) with 0.5% NP40 protein extraction buffer containing protease and phosphatase inhibitors (Roche), on ice ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were harvested and ruptured with a Dounce homogenizer in the buffer A containing cOmplete protein inhibitor cocktail (Roche) and 1mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were obtained by lysing cells in PBS containing 0.1% Triton X-100 (PBS/TX) as well as protease and protein inhibitor cocktails (Roche) for 5 min on ice ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein was eluted with wash buffer containing 10 mM maltose and subsequently bound to c0mplete His tag resin (Roche) for 2 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... Whole cellular protein was extracted with RIPA buffer (Serva electrophoresis) containing protease inhibitor cocktail and phosphatase inhibitor cocktail (Roche). Western blots were performed following routine protocols55 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and CAT expression was quantified using the CAT ELISA (Roche) as per the manufacturer’s instructions ...