Labshake search
Citations for Roche :
401 - 450 of 5376 citations for Human Cyclin Y Like 3 CCNYL3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... 3) 2hr RT incubation in blocking solution (5% Sheep Serum, 1% Roche Blocking Buffer in PBST); 4 ...
-
bioRxiv - Neuroscience 2019Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) substrate (Roche Diagnostics). Color development was allowed to proceed overnight or was stopped after 2-3 hours (for quantification of npba expression in Vs/Vp ...
-
bioRxiv - Neuroscience 2020Quote: ... The colometric reaction was performed using mixture of 5-Bromo-4-chloro-3-indolyl phosphate (Roche) and Nitro blue tetrazolium chloride (Roche).
-
bioRxiv - Plant Biology 2021Quote: ... and BCIP (5-Bromo-4-chloro-3-indolyl phosphate)-NBT (nitro blue tetrazolium) chromogenic substrates (Roche). Images were captured by Apotome2 Zeiss microscope system.
-
bioRxiv - Cell Biology 2022Quote: ... HeLa cells were reverse transfected with 1:3 or 1:6 X-tremeGENE 9™ (Roche) transfection reagent according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
Liver X Receptor activation regulates genes involved in lipid homeostasis in developing chondrocytesbioRxiv - Physiology 2019Quote: ... This was followed by a 1.5-2 hour incubation in Collagenase-P (3 mg/mL, Roche) diluted in Dulbecco’s Modified Eagles Medium (DMEM ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’UTRs and 3’UTRs amplifications were performed using either Expand High Fidelity PCR System (Roche) or KAPA HiFi PCR system (KAPA Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... washed in FACS buffer (4% FBS, 3 mM EDTA, and 40 μg/ml DNAse I (Roche)) and incubated with combinations of antibodies to CD45 (30-F11) ...
-
bioRxiv - Systems Biology 2023Quote: ... 500 mM NaCl and 3 mM Dithiothreitol (DTT)) supplemented with 1 mg deoxyribonuclease I (DNaseI, Roche) and protease inhibitor 4-(2-Aminoethyl ...
-
bioRxiv - Neuroscience 2023Quote: ... and nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 5 hours ...
-
bioRxiv - Immunology 2023Quote: ... ‘reverse’ 5’-GGGTACTTGATTTCATAGACTTTA-3’) were used in a qRT-PCR on a LightCycler 480 II (Roche). The data were analysed with LightCycler® 96 SW 1.1 (Roche) ...
-
bioRxiv - Immunology 2023Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) substrate (Roche Diagnostics) for chromogenic detection ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated in digestion solution (3 mg/mL collagenase D [Roche] in DMEM/F-12 [Gibco]) for 45 min at 37 °C with intermittent vortex mixing to dislodge soft tissues ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl of 10% SDS and 5 μl of 10 mg/ml Proteinase K (Roche, #31158) were added and incubated at 50 °C for 1 h ...
-
bioRxiv - Physiology 2024Quote: ... with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 1 hour (gal) ...
-
bioRxiv - Physiology 2024Quote: ... and visualized using 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium substrate (Roche Diagnostics). After color development for 15 min (gal) ...
-
bioRxiv - Cell Biology 2024Quote: ... with primer set #3 (Supplementary Table 1) using KAPA High-Fidelity DNA Polymerase (KAPA Biosystems, KE2502). The forward and reverse primers contained BspEI and KpnII sites respectively ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were resuspended and washed twice in 3 ml Red Blood Cell Lysis Buffer (Roche) to remove any visible blood cells ...
-
bioRxiv - Immunology 2021Quote: ... Culture media was supplemented with 500 U/mL human IL-2 (Tecin from Roche, kindly provided by the NIH) starting on culture day 2 ...
-
bioRxiv - Microbiology 2021Quote: ... and human acute promyelocytic leukemia cell line NB4 (ATCC) were washed once with the digestion buffer for neuraminidase (Roche), the cells were centrifuged at 2000 rpm for 5 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 ng of nick translated probe per coverslip was combined with 12 μg of human Cot-1 DNA (Roche), 10 μg salmon sperm ssDNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... and NexCreERT2::R26R-tdT male mice received intraperitoneal injections (i.p.) of recombinant human (rh)EPO (5000 IU/kg body weight; NeoRecormon, Roche) or PL (solvent solution ...
-
bioRxiv - Neuroscience 2023Quote: Human induced pluripotent stem cell (iPSC) line KYOU-DXR0109B (ATCC) was routinely cultured on growth-factor reduced Matrigel (Roche) in mTeSR1 culture medium (StemCell Technologies ...
-
bioRxiv - Immunology 2024Quote: ... NK cells were cultured for the indicated amount of time with or without human IL-2 (TECINTM; teceleukin, ROCHE), human IL-15 (247-IL/CF ...
-
bioRxiv - Genomics 2022Quote: ... High Sensitivity DNA Analysis Kit and KAPA SYBR FAST qPCR Kit (Roche). WGS was performed on the HiSeq X (HCS HD 3.5.0.7 ...
-
bioRxiv - Cell Biology 2020Quote: ... per sample was washed 3 times with cold 1X PBS and 2μg anti-GFP monoclonal antibody (Roche) per sample was conjugated with Dynabeads in 1ml cold PBS at 4°C for 4h ...
-
bioRxiv - Microbiology 2019Quote: ... and CO2 reverse primer (5′-TACCTTGTTACGACT-3′)53 with KAPA Lightcycler 480 mix (KAPA Biosystems Ltd., UK) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... 25µl of Red ANTI-FLAG M2 Affinity Gel from SIGMA ALDRICH (F2426) were washed 3 times with TBS (50mM TRIS pH 7.5,150mM NaCl and protease inhibitor tablets [Roche]) and then added to samples ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 µl Universal Nuclease Mix (Pierce™) and 1 tablet of cOmplete™ Protease Inhibitor Cocktail (Roche) were added and the cells were lysed via sonication ...
-
bioRxiv - Microbiology 2022Quote: ... at 37 °C for 3 hours followed by 19 μg/sample of trypsin (Roche Cat. Nr. 11418025001) at 37 °C for 13 hours ...
-
bioRxiv - Microbiology 2019Quote: ... were transfected with 20 ng pNF-□B-Luc and 3 ng pRL-TK using FuGENE 6 (Roche). Transfected cells were incubated for 24 h (37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 min) and plated onto 1.5 % agar TAP plate containing 10 µg mL-1 hygromycin B (Roche) and 20 µg mL-1 of paromomycin sulfate (Fisher BioReagents).
-
bioRxiv - Immunology 2020Quote: ... gently mechanically disaggregated and resuspended in PBS 1x containing 3 mg/ml of collagenase D (Roche Diagnostics) plus 10 μg/ml of DNAse (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... The harvested molars were pooled and dissociated with 3 U/mL Collagenase P (COLLA◻RO, ROCHE) followed by incubation for 45◻minutes in a 37°C shaking water bath ...
-
bioRxiv - Genomics 2021Quote: Mice livers were perfused and dissociated into single cells using Liberase Blendzyme 3 recombinant collagenase (Roche Diagnostics) as previously described8 ...
-
bioRxiv - Neuroscience 2022Quote: ... R: 5’-GACCTGCAGGAGGATCGTAG −3’) was determined by qPCR using FastStart Essential DNA Green Master Mix (Roche, 06402712001) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... Chloroplast were lysed osmotically in buffer 3 (25mM HEPES-KOH, pH 8.0) containing cOmplete protease inhibitor (Roche) and either separated into soluble and pellet fraction by centrifugation for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 mM MgCl2; 0.1 % NP-40; 0.2 U/µl RNaseOUT; 0.32 M Sucrose; 1x protease inhibitor, Roche) and transferred to 2 ml Dounce tissue grinder (Sigma) ...
-
bioRxiv - Genomics 2023Quote: Mastermix 3 (IS-PCR) was freshly prepared and contained 12.5 μl Kapa HiFi Hotstart Readymix (2x, Roche), 0.25 μl IS PCR Primers (10 μM ...