Labshake search
Citations for Roche :
401 - 431 of 431 citations for Human CMTR2 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... Plasmid was cut and antisense probe was synthesized by in vitro transcription with Dig RNA Labeling Mix (Roche, Cat. No. 11277073910) or Fluorescein RNA labeling mix (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfection was performed on six-well plates or confocal dishes for different purposes with plasmids using X-tremeGENE HP DNA Transfection Reagent (Roche, 6366236001) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... and a sgRNA preceded by a rrk1 leader and followed by a Hammerhead Ribozyme as described in [17] was digested and prepared for gap repair as follows: the vector pJB166 was purified from DH5α bacterial cells using the Genopure plasmid midi kit (Roche, 03143414001) and diluted to 1 μg/μL ...
-
bioRxiv - Bioengineering 2022Quote: ... Slides were blocked in 10% BSA and 0.05% Tween 20 in PBS for 30 minutes before application of one of the following antibodies: mouse anti-human p16INK4a (CINTEC-Roche, cat# 705-4793), rabbit anti-human alpha-smooth muscle actin or aSMA (Abcam ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... HEK293 cells were transiently transfected with β-arrestin 2-Renilla luciferase 8 (Rluc8) and human C5aR2-Venus constructs using XTG9 (Roche, Sydney, Australia) for 24 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... frozen human samples were disrupted in 600 µl of lysis buffer containing green ceramic beads using the MagNA Lyser Instrument (Roche Life Science, Germany). The cDNA synthesis was performed in a 20-µl reaction using random hexamers ...
-
bioRxiv - Microbiology 2022Quote: ... Quantification of beta-globin was performed by a commercially available human genomic DNA kit (The LightCycler Control Kit DNA, Roche Diagnostics, Basel, Switzerland)69.
-
bioRxiv - Genomics 2019Quote: ... trachomatis molecular diagnosis was performed by using a dual-target (chromosome plus plasmid) commercial nucleic acid amplification test (NAAT) (Cobas® 4800 CT/NG from Roche Diagnostics) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... The riboprobes were obtained by rub-off transcriptions of linearized pBlueScript plasmids containing the full retrozymes in the presence of DIG-UTP (Roche Diagnostic GmbH) (26).
-
bioRxiv - Immunology 2021Quote: ... NGS libraries were generated following a two-step primer extension protocol.70 30 μg of plasmid DNA were amplified using Kapa Hifi HotStart Ready mix (Kapa Biosystems, KK2602) in a 50 μl reaction using primers EpMap_7 and EpMap_8 (which bound to regions that were ~70 bp away from the peptide encoding region ...
-
bioRxiv - Epidemiology 2020Quote: ... plasmids or DNA samples (Table 1) by real-time TaqMan PCRs assays on a LightCycler® 480 (LC480) (Roche Applied Science, Germany). Real-time PCR assays were performed with LightCycler® 480 Probe Master Mix 1× (Roche Applied Science ...
-
bioRxiv - Neuroscience 2020Quote: ... Anti-sense riboprobes against target genes were synthesized from 5 µg linearized plasmids using digoxigenin-(DIG) or fluorescein-labeled uridylyltransferase (UTP) (#11685619910, #11277073910, Roche, Mannheim, Germany) and the MAXIscript in vitro Transcription Kit (#AM1312 ...
-
bioRxiv - Developmental Biology 2021Quote: Digoxigenin-labelled sense and antisense RNA probes were prepared by in vitro transcriptions using recombinant plasmids of target genes made as mentioned above (Roche Life Science) and used for in situ hybridization ...
-
bioRxiv - Microbiology 2021Quote: Plasmids were transfected into HeLa cells growing on 100 mm dishes using X-treme GENE HP DNA transfection reagent (Roche, Laval, QC) according to manufacturer’s protocols and processed for TEM at 18 hours post transfection ...
-
bioRxiv - Molecular Biology 2022Quote: ... we performed a mutagenesis PCR using the primers [Phos]ATCGATTACAAGGATGACGATGACAAGGGTGGTGGTGGTAGTATGAAGCTACTGTCT TCTATCGAA and [Phos]GTCATGATCTTTATAATCACCGTCATGGTCTTTGTAGTCCATTTTGAAGTGGCCTGAA GTAAAGGA and the validation plasmid as template (25 μl KAPA HiFi HotStart ReadyMix (KAPA Biosystems KK2602), 1 μl 100 μM forward primer ...
-
bioRxiv - Microbiology 2022Quote: ... then guide sequences were amplified from gDNA and the plasmid pool by nested PCR using KAPA HIFI Hotstart PCR kit (Kapa Biosystems, KK2501), as previously described in (Young et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... the plasmid DNA was linearized by SalI digestion and transcribed by T7 RNA polymerase using Digoxigenin (Dig) RNA Labeling Mix (Roche Diagnostics, Germany) for 2 h at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... UGGT2-/- and UGGT1/2-/-cells were transfected with 1 µg Trop-2-pEYFP-N1 or Trop-2-Q118E-pEYFP-N1 plasmids using X-tremeGENE 9 DNA transfection reagent (Roche, Basel, Switzerland) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... the cDNA inserts of the plasmids were isolated and amplified by low-cycle (12x) PCR using a Kapa2G Robust Hotstart PCR kit (Roche, Ref #07961073001) according to specifications ...
-
bioRxiv - Neuroscience 2024Quote: ... Antisense riboprobes against target genes were synthesized from 5 μg linearized plasmids using digoxigenin-(DIG) or fluorescein-labeled uridylyltransferase (UTP) (#11685619910, #11277073910, Roche, Mannheim, Germany) and the MAXIscript in vitro Transcription Kit (#AM1312 ...
-
bioRxiv - Immunology 2024Quote: 293T cells were co-transfected with plasmids encoding cognate heavy and light chains using the Xtreme Gene 9 DNA transfection reagent (Roche, Basel, Switzerland), then grown in Dulbecco’s modified Eagle medium supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... We induced transient expression of the plasmids in 106 cells resuspended in 2 ml using the polymer X-tremeGENE 9 DNA Transfection Reagent (Roche Applied Sciences 06365787001) following manufacturer’s instructions (1 μg total DNA and 3 μl reagent in 100 μl FBS-free culture medium) ...
-
bioRxiv - Microbiology 2020Quote: ... and 5 µg of a WEAU gp160 plasmid (pcDNA3.1-WEAU gp160) into exponentially dividing 293T/17 cells using FuGENE 6 (Roche Applied Science, Indianapolis, IN) or into 293F cells using 293fectin (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... All transfections were performed with cells in exponential growth using either X-tremeGENE siRNA (for siRNA) and X-tremeGENE HP DNA (for plasmids) (Roche, Indianapolis, IN, USA).
-
bioRxiv - Developmental Biology 2022Quote: ... Digoxygenin-labeled sense and antisense probes were synthesized from the linearized plasmids using the DIG RNA Labeling Kit (SP6/T7) (Roche/MilliporeSigma, Burlington, MA). Whole-mount ISH was performed as previously described (Yan et al. ...
-
bioRxiv - Genetics 2023Quote: ... 1 µL of each primer Oligo 90 and Oligo 91 were combined with 50 ng of sample plasmid DNA and 25 µL Kapa Hifi Hotstart ReadyMix (Kapa Biosystems Cat# KK2602), and topped off with water to a total volume of 50 µL ...
-
bioRxiv - Immunology 2021Quote: ... Viral copies/ml of peripheral blood was calculated using the standard curve generated with serially diluted cloned DNA standard plasmids (Roche Molecular System, Pleasanton, CA).
-
bioRxiv - Microbiology 2020Quote: ... with plasmids containing the viral genome (described in (Sutherland et al., 2018)) using X-tremeGENE™ HP DNA Transfection Reagent (Roche, Indianapolis, IN, USA). Supernatants were applied to RAW264.7 cells (ATCC ...
-
bioRxiv - Developmental Biology 2020Quote: ... Riboprobes were synthesized from the plasmids by in vitro transcription using either T7 or Sp6 polymerase and a digoxigenin (DIG) labeling kit (Roche Applied Science, Indianapolis, IN). The primer sequences used for riboprobe preparation are given in Supplemental Table 1.
-
bioRxiv - Genetics 2022Quote: ... The hygromycin cassette including the B-tubulin promoter and terminator was amplified from pPHT1 plasmid with the KAPA HiFi HotStart PCR kit (Kapa Biosystems, Wilmington, MA, USA). The PCR thermocycling profile used was as follows ...
-
bioRxiv - Microbiology 2023Quote: ... ZAP KO HEK293T cells were transfected with equal amounts of the transposase plasmid and an ePB transposon vector containing WT or mutant ZAP using X-tremeGENE9 DNA Transfection Reagent (Roche Life Science, Basel, Switzerland) in Opti-MEM (Thermo Fisher Scientific ...