Labshake search
Citations for Roche :
151 - 200 of 749 citations for Hepatitis C Virus Core Antigen HCcAg since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2023Quote: ... α-c-Myc (1:2000, Roche diagnostics), DM1A (1:1000 ...
-
bioRxiv - Microbiology 2023Quote: ... the pocks positive for both BleCherry and GFP signals (pocks containing the recombinant green/red virus) were isolated for DNA extraction using High Pure Viral Nucleic Acid Kit (Roche Diagnostics GmbH, Mannheim, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... for 90 min at 37 °C and digested overnight at 37 °C in 1.5 mg/ml collagenase B solution (Roche). Then ...
-
bioRxiv - Cell Biology 2021Quote: ... for 90 minutes at 37°C and digested overnight at 37°C in 1.5 mg/ml collagenase B solution (Roche) under continuous agitation ...
-
bioRxiv - Microbiology 2021Quote: ... The mixture was re-incubated 20 min at 75°C and the purified DNA product further incubated overnight at 16°C with a T4 DNA ligase (Roche).
-
bioRxiv - Cell Biology 2022Quote: ... 30 s at 72°C) and final extension 5 min at 72°C using KAPA Taq DNA polymerase (KAPA BIOSYSTEMS). PCR products were visualized on 2% agarose gels containing SYBR Safe DNA gel stain (Invitrogen) ...
-
bioRxiv - Immunology 2022Quote: ... pursued by 95°C for 3 min and then 45 cycles at 95°C for 15 sec and 58°C for 30 seconds using a LightCycler-480 Real-Time PCR system (Roche). The primers and the probes were designed against the E gene17.
-
bioRxiv - Microbiology 2020Quote: ... followed by 45 cycles of amplification under the following conditions: 94°C for 15 s and 60°C for 60 s in a LightCycler 96 (Roche).
-
bioRxiv - Microbiology 2021Quote: ... followed by 95 °C for 2 min and then 45 cycles of 95 °C for 15 s and 60 °C for 30 s using a Light Cycler 480 (Roche).
-
bioRxiv - Microbiology 2023Quote: ... followed by 95 °C for 2 min and then 45 cycles of 95 °C for 15 s and 60 °C for 30 s using a Light Cycler 480 (Roche).
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-c-myc 9E10 (Roche, 11667203001); mouse monoclonal anti-FLAG M2 (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2020Quote: ... alkylated and digested with endoproteinase Lys-C (Roche) followed by modified trypsin (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... Monoclonal anti–c-myc antibody was from Roche Applied Science (Indianapolis ...
-
bioRxiv - Physiology 2020Quote: ... on the Cobas C-501 autoanalyzer (Roche, Switzerland), and FFA levels were measured using a Wako Chemicals kit (Richmond ...
-
bioRxiv - Cell Biology 2021Quote: ... alkylated and digested with endoproteinase Lys-C (Roche) followed by modified trypsin (Promega)62,63 ...
-
bioRxiv - Plant Biology 2022Quote: ... anti-c-myc-peoxidase (Roche, 11814150001; 1:10,000) and anti-HA-peroxidase (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... at 4°C with protease inhibitors cocktail (Roche). After 20 minutes centrifugation at 13000 g at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... at 4°C with protease inhibitors cocktail (Roche). After 20 minutes of centrifugation at 13000 g at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... for 40 cycles at 95°C for 5 s and 60°C for 30 s on a Light Cycler 480 Real-Time PCR System (Roche, Switzerland). All primer sequences used in this study are listed in Supplementary materials (Supplementary Table S1).
-
bioRxiv - Microbiology 2022Quote: ... followed by 40 cycles of amplification (95°C for 15 sec, 60°C for 30 sec) (Roche LightCycler 96, Roche Diagnostics). For absolute quantification ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 s at 68 °C before final extension for 60 s at 68 °C) using the KAPA HiFi HotStart ready mix (KAPA Biosystems) before purification twice over 1X KAPA Pure beads (KAPA Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 s at 68 °C before final extension for 60 s at 68 °C) using the KAPA HiFi HotStart ready mix (KAPA Biosystems) before purification twice over 1X KAPA Pure beads (KAPA Biosystems) ...
-
bioRxiv - Microbiology 2022Quote: ... 45 cycles of 95°C for 3 s and 60°C for 30 s using the LightCycler 96 system (Roche, Basel, Switzerland) or the StepOnePlus™ Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Immunology 2020Quote: ... pursued by 95°C for 3 minutes and then 45 cycles at 95°C for 15 seconds and 58°C for 30 seconds using a LightCycler 480 Real-Time PCR system (Roche, Rotkreuz, Switzerland). The primers and the probes were designed against the E gene (20).
-
bioRxiv - Immunology 2020Quote: ... cultured in vitro at 30 °C and at 37 °C in EMJH medium was also extracted using a High Pure RNA Isolation kit (Roche Applied Science) following the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were incubated overnight at 4°C in Odyssey blocking buffer containing 0.1% Tween-20 at 4°C and 1/1000 dilution of anti-c-myc mouse monoclonal antibody (Catalogue number 11 667 149 007, Roche, Bâle, Switzerland) or anti-β-tubulin mouse antibody (Catalogue number T9026 ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were pelleted at 500 x g for 5 min at 4°C and resuspended in 10 ml 4 °C RSB supplemented with protease inhibitor (cOmpletetm, EDTA-free protease inhibitor cocktail, Roche, Cat#: 11873580001) and incubated on ice for 15min ...
-
bioRxiv - Genomics 2020Quote: ... Paraffinized at 72°C with EZ solution (Roche Ventana). Antigen for SOX17 was retrieved via CC1 protocol with prediluted Tris solution ...
-
bioRxiv - Cell Biology 2019Quote: ... The anti-c-Myc antibody was purchased from Roche. Restriction enzymes and Gibson assemble master mix was purchased from New England Biolabs ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 4 °C overnight and protein G-Agarose (Roche) at 4 °C for 3 h ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 sec at 97°C in a LightCycler96 (Roche).
-
bioRxiv - Cancer Biology 2024Quote: ... and Proteinase K (Roche; 1 h at 55 °C) and DNA recovered using PCR purification kit (Qiagen).
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR reactions were run for 50 cycles (95 °C for 15 s and 60 °C for 45 s) on a LightCycler 480 (Roche Diagnostics, Mannheim, Germany). Each sample was examined in three technical replicates and dissociation curves were analysed to verify the specificity of each amplification reaction ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Probes were hybridized at 56°C overnight and subsequently detected by anti-DIG at 4°C overnight (1:1000; Roche 11-207-733-910) with secondary tyramide signal amplification for 2h at room temperature in the dark (AKOYA Biosciences ...
-
bioRxiv - Microbiology 2022Quote: ... initial denaturation at 95°C for 3 min, followed by 40 cycles of amplification (95°C for 15 sec, 60°C for 30 sec) (Roche LightCycler 96, Roche Diagnostics). For absolute quantification ...
-
bioRxiv - Cancer Biology 2020Quote: ... cooling: 37 °C for 30 s (LightCycler® 96, Roche). For relative quantification ...
-
bioRxiv - Cell Biology 2020Quote: ... iPSCs were cultured in iPSCs media over mitomycin C (Roche)-inactivated feeder cells ...
-
bioRxiv - Biophysics 2022Quote: ... C-33A cells were transiently transfected using FuGENE 6 (Roche) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... Subsequent digestions with Endo-Protease Lys-C (Roche Diagnostics, USA) and trypsin (1:20 enzyme/protein ratio ...
-
bioRxiv - Molecular Biology 2020Quote: ... Primary antibodies were c-Myc (monoclonal, from mouse, by Roche) and c-Myc (polyclonal ...
-
bioRxiv - Microbiology 2022Quote: ... Resuspended protein samples were digested with endoproteinases Lys-C (Roche) and trypsin (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... at 37°C for 20 minutes and Proteinase K (Roche) overnight at 65°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... 0.25% Triton supplemented with protease inhibitor at 4□°C (Roche, 04693159001) for 10 min ...
-
Control of cortical cytoskeleton-membrane interaction by RhoA regulates peripheral nerve myelinationbioRxiv - Neuroscience 2021Quote: ... was performed for 1.5h at 37°C with TdT enzyme (Roche) and dATP (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... for 20 minutes at 37°C and then Proteinase K (Roche) overnight at 65°C ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... at 4°C overnight and subsequently developed with NBT/BCIP (Roche). For FISH ...
-
bioRxiv - Immunology 2019Quote: ... and subjected to 1 hour treatment with bacterial sialidase C (Roche) at 37C ...
-
bioRxiv - Neuroscience 2020Quote: ... at 4°C with alkaline phosphate anti-DIG (1:2000, Roche). For chromogenic revelation ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Digoxigenin-labeled c-fos sense and antisense probes (11277073910, Merk (Roche), UK ...