Labshake search
Citations for Roche :
51 - 100 of 446 citations for HCN2 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were washed in PBSTr and incubated overnight at 4 °C MABTr/10% sheep serum (Sigma-Aldrich)/2% Blocking solution (Roche, Switzerland) with anti-Fluorescein-POD Fab fragments serum (1:500 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were incubated overnight at 4°C in 0.1M malic acid/0.1%-TritonX (MABTr)/10% sheep serum (Sigma-Aldrich)/2% Blocking solution (Roche, Switzerland) with anti-DIG-AP Fab fragments serum (1:5000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... embryos were incubated overnight at 4 °C in blocking solution MABTr/10% sheep serum (Sigma-Aldrich)/2% Blocking solution (Roche, Switzerland) with anti-DIG-POD Fab fragments serum (1:500 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5% Blocking reagent (Roche 11096176001) and 10 mM Tris ...
-
bioRxiv - Physiology 2022Quote: ... 1.98% Blocking Reagent (11096176001, Roche), 49.5% formamide ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% blocking reagent (Roche, 11096176001), 1% bovine serum albumin (Sigma ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 0.5% blocking solution (Roche)] containing 100nM telomeric PNA probe TelC-FITC (F1009 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... 2% blocking reagent (Roche, #11096176001), 10% heat-inactivated sheep serum (Equitech-Bio ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% blocking reagent (Roche #11096176001) in MABT at room temperature for 30 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 0.5% blocking solution (Roche)] containing 100nM telomeric PNA probe TelC-FITC (F1009 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 3% Blocking Reagent (Roche) to the hybridization mix during overnight blocking and hybridization of the probe ...
-
bioRxiv - Developmental Biology 2023Quote: ... in 2% Blocking Reagent (Roche) and 5% sheep serum (Sigma ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5mg/ml blocking reagent (Roche), and 0.5ug/ml biotinylated LNA probe against SATII (based on the sequence ATTCCATTCAGATTCCATTCGATC (Swanson et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... After blocking for 1-2h with the 1% blocking reagent (Roche Applied Science, cat# 10057177103), sections were incubated with alkaline phosphatase-conjugated anti-DIG antibody (1:1000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... pH 7.5) and blocked in MABT blocking buffer [MABT containing 1% blocking reagent (Roche #11096176001)] with 10% sheep serum for 2,5 hours at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... pH 7.5) and blocked in MABT blocking buffer [MABT containing 1% blocking reagent (Roche #11096176001)] with 10% sheep serum for 2.5 hours at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: Immunostaining was performed after FISH development by re-blocking planarians in Blocking Solution (5% heat inactivated horse serum, 5% Roche Western Blocking Buffer in TNTx) for 2 hours at room temperature ...
-
bioRxiv - Cell Biology 2019Quote: ... 3) 2hr RT incubation in blocking solution (5% Sheep Serum, 1% Roche Blocking Buffer in PBST); 4 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Blocking of membranes was carried out in buffer 2 (buffer 1 plus 1% blocking reagent (Roche)) for 30 min ...
-
bioRxiv - Neuroscience 2022Quote: ... Slides were incubated in ISH blocking buffer (10% lamb serum 0.2% Roche blocking reagent in TBS) for 1 hour at room temperature and then incubated overnight at 4°C in HRP-conjugated anti-DIG or anti-FL antibodies (in key resource table) ...
-
bioRxiv - Neuroscience 2022Quote: ... Following 1 hour incubation in blocking buffer (10% lamb serum, 0.2% Roche blocking reagent in TBS), the slides were incubated overnight at 4°C in HRP-conjugated anti-DIG or anti-FL antibodies ...
-
Single-cell analysis of shared signatures and transcriptional diversity during zebrafish developmentbioRxiv - Developmental Biology 2023Quote: ... animals in PBST were rocked in 2% blocking buffer (5 g of blocking reagent, Roche, 11096176001) in 1X maleate buffer (150mM maleic acid ...
-
bioRxiv - Developmental Biology 2023Quote: ... Slides were then washed in 0.2x SSC and MBST before blocking with 2% blocking solution (Roche) for at least 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2019Quote: ... blocked with blocking reagent (Roche/Merk) and incubated with anti-DIG antibody conjugated with alkaline phosphatase (AP) ...
-
bioRxiv - Cell Biology 2020Quote: ... blocked in 1xWestern Blocking Reagent (Roche) and labeled for IF imaging ...
-
bioRxiv - Developmental Biology 2021Quote: ... incubated in blocking solution (Sigma Roche) for 1 hour at room temperature before incubation with anti-DIG antibody (1:4000-5000 in blocking solution) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and blocked using Blocking Reagent (Roche). DIG-labeled probes were detected using mouse monoclonal anti-DIG primary antibody (Roche ...
-
bioRxiv - Developmental Biology 2021Quote: ... in 0.5% blocking reagent (Roche, 11096176001), in PBT at 4°C.
-
bioRxiv - Neuroscience 2021Quote: ... in 0.5% blocking reagent (Roche, 11096176001) for 24 h ...
-
bioRxiv - Neuroscience 2020Quote: ... we used 2% Blocking Reagent (Roche) in PBS with 0.1% Tween-20 ...
-
bioRxiv - Developmental Biology 2019Quote: ... blocked with western blocking reagent (Roche) and incubated with anti-dig or anti-flu ...
-
bioRxiv - Developmental Biology 2020Quote: ... in 2% blocking solution (Roche 11096176001) were used for RNA probe detection ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... diluted in 1% blocking reagent (Roche) on 1× PBS for 1h at RT ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1% blocking solution (#11096176001, Roche) for 3 minutes at 85°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... in 1% blocking regent (Roche, 1096176)/PBS ...
-
bioRxiv - Developmental Biology 2019Quote: ... slides were washed in 0.2x SSC then transferred to MBST before blocking with 2% blocking solution (Roche) for at least 1 hr at RT ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5% blocking buffer pH 7.5 (100 mM maleic acid, 150 mM NaCl, 10% Roche blocking reagent #11096176001). Antibody staining was performed in 3% BSA in PBS-Triton (0.1%) ...
-
bioRxiv - Developmental Biology 2021Quote: ... they were incubated for 1 hour in blocking solution (Tris 0.1M pH 7.5, NaCl 150mM, Tween-20 0.1% and 5% blocking reagent Roche) and then with POD-conjugated anti-FITC antibody (11426346910 ...
-
bioRxiv - Neuroscience 2021Quote: ... Slide were moved to a humid chamber and blocked with blocking solution (MAB 1×, blocking reagent (Roche) 2% ...
-
bioRxiv - Developmental Biology 2023Quote: ... Samples were soaked in blocking solution (5% sterile horse serum, 0.5% Roche western blocking reagent in TNTx) for two hours at room temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... rinsed in TBS/0.1% Tween-20 and incubated overnight in blocking buffer (TBS with 2% goat serum, 0.1% blocking reagent (Roche), 0.1% Tween-20 ...
-
bioRxiv - Neuroscience 2019Quote: ... then immersed in 0.1 M maleate buffer (pH 7.5) for 10 minutes before blocking in 1% Blocking Reagent (Roche) for 10 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... The sections were blocked in Blocking Buffer (5% sheep serum with 10% Roche Blocking Reagent 10x in MABT) for 1 hr at RT and incubated overnight with anti-Digoxigenin-AP (1:4000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 % blocking reagent before incubation in a blocking solution with anti-DIG alkaline phosphatase (AP) conjugated antibody (Roche) diluted 1 ...
-
bioRxiv - Cell Biology 2023Quote: ... the coverslips were incubated with 1× blocking solution (Blocking Reagent [Roche] and TBST [TBS and 0.1% Tween 20]) at room temperature for 1 h ...
-
bioRxiv - Microbiology 2021Quote: ... HA peptide (400 μg/ml Roche) or cMyc peptide (200 μg/ml Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 2% Boehringer Mannheim Blocking Reagent (Roche) in MABTL ...
-
bioRxiv - Neuroscience 2020Quote: ... slices blocked with 10% Blocking Reagent (Roche) in 100mM maleic acid/150mM NaCl/0.01% Tween20 pH7.5 and incubated O.N ...
-
bioRxiv - Developmental Biology 2021Quote: ... Embryos were incubated in blocking solution (Roche) for 30 minutes and AP-conjugated anti-DIG (1:2000 ...
-
bioRxiv - Physiology 2020Quote: ... blocked with 1X Western Blocking Reagent (Roche), and incubated with anti-Cyp2f2 primary antibody (sc-374540 ...