Labshake search
Citations for Roche :
251 - 300 of 709 citations for HCC 4 CCL16 Human CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... cells were stained with 4′,6-diamidino-2-phenylindole (DAPI) (Roche, 10236276001; 1:10,000) for 5 minutes ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 400nM 5-Bromo-4-chloro-3-indolyl phosphate p-toluidine salt (BCIP, Roche).
-
bioRxiv - Biochemistry 2024Quote: ... tissues were lysed in RIPA buffer (ratio 1:4) supplemented with protease inhibitors (Roche) and protein was quantified by BCA Protein Assay Kit assay.
-
bioRxiv - Genomics 2024Quote: ... and incubated overnight at 4°C with Anti-Dig-AP antibody (Roche, 1:5000) in 1% lamb serum ...
-
bioRxiv - Immunology 2021Quote: ... Culture media was supplemented with 500 U/mL human IL-2 (Tecin from Roche, kindly provided by the NIH) starting on culture day 2 ...
-
bioRxiv - Neuroscience 2019Quote: ... barcoded and enriched using the NimbleGen SeqCap EZ Human Exome Library v2.0 enrichment kit (Roche NimbleGen, Madison, WI, USA). Purified and quantified library pool was subsequently sequenced on an Illumina HiSeq 2000 sequencing instrument (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... and human acute promyelocytic leukemia cell line NB4 (ATCC) were washed once with the digestion buffer for neuraminidase (Roche), the cells were centrifuged at 2000 rpm for 5 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 ng of nick translated probe per coverslip was combined with 12 μg of human Cot-1 DNA (Roche), 10 μg salmon sperm ssDNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... and NexCreERT2::R26R-tdT male mice received intraperitoneal injections (i.p.) of recombinant human (rh)EPO (5000 IU/kg body weight; NeoRecormon, Roche) or PL (solvent solution ...
-
bioRxiv - Neuroscience 2023Quote: Human induced pluripotent stem cell (iPSC) line KYOU-DXR0109B (ATCC) was routinely cultured on growth-factor reduced Matrigel (Roche) in mTeSR1 culture medium (StemCell Technologies ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Immunology 2024Quote: ... NK cells were cultured for the indicated amount of time with or without human IL-2 (TECINTM; teceleukin, ROCHE), human IL-15 (247-IL/CF ...
-
bioRxiv - Developmental Biology 2021Quote: ... They are incubated for at least 4 hours in blocking solution 1x WBR (Roche, 11921673001) and incubated overnight at 4°C with anti-Digoxigenin antibody coupled to alkaline phosphatase (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: For sequencing all samples were treated with 4 mg/ml of proteinase K (Roche Diagnostics). RNA and small RNA were extracted and enriched in separate fraction from the supernatants using the mirVana kit according to manufacturer’s instructions to separate samples into two groups ...
-
bioRxiv - Genomics 2019Quote: All buffers were pre-chilled to 4°C with cOmplete EDTA-free protease inhibitor (Roche) freshly added ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... animals were incubated overnight with peroxidase-conjugated antibodies at 4°C (anti-DIG-POD, Roche 1:500 dilution and anti-DNP ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and Nitro Blue tetrazolium/5-bromo-4-chloro-3-indolyl-phosphate NBT/BCIP (Roche Diagnostics). In situ hybridizations were based on the Carroll lab “Drosophila abdominal in situ” protocol (http://carroll.molbio.wisc.edu/methods.html ...
-
bioRxiv - Neuroscience 2020Quote: ... sections are incubated with DAPI (4′,6-diamidino-2-phenylindole, Cat. no. 10236276001 Roche, Switzerland) for 10 minutes at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... which were stained with 5-bromo-4-cloro-3-indlyl phosphate/nitro blue tetrazolium (Roche) chromogenic substrates.
-
bioRxiv - Neuroscience 2021Quote: ... 4 μL of the supernatant were incubated with 20 μg/mL proteinase K (PK; Roche) in a total volume of 22 μL RIPA buffer for 1 hr at 37°C to digest all proteins except for PK-resistant PrPSc ...
-
bioRxiv - Developmental Biology 2020Quote: ... in the presence of nitro blue tetrazolium/5-bromo-4-chloro-3′-indolyphosphate substrates (Roche). Stained embryos and gonads were embedded in gelatin ...
-
bioRxiv - Neuroscience 2020Quote: ... MgCl2 50 mM] and incubated in 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Roche) and 4-nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were incubated overnight at 4 °C with rat anti-HA antibody (1:500 - Roche) and then with secondary goat anti-rat IgG antibody coupled to Alexa 568 (Invitrogen/Life Technologies ...
-
bioRxiv - Developmental Biology 2020Quote: ... and then incubated in nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate solution (Roche).
-
bioRxiv - Neuroscience 2020Quote: ... and nitro-blue tetrazolium chloride (NBT)/5-bromo-4-chloro-3′-indolyphosphate (BCIP) substrate (Roche) according to published protocols ...
-
bioRxiv - Microbiology 2019Quote: ... and suspended in 4 mL of HB supplemented with cOmplete™ Protease Inhibitor Cocktail (Roche) and 5 µg/mL cytochalasin D (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by NBT/BCIP (nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate) reaction (Roche). After in situ hybridization ...
-
bioRxiv - Cell Biology 2021Quote: ... in the presence of nitro blue tetrazolium/5-bromo-4-chloro-3′-indolyphosphate substrates (Roche). Stained testicular explants were embedded in gelatin ...
-
bioRxiv - Cancer Biology 2022Quote: Cells were lysed at 4°C in RIPA buffer supplemented with protease inhibitors (Roche, 4693159001). Protein concentrations were measured using a BCA Assay Kit (Thermo Fisher ...
-
bioRxiv - Genetics 2022Quote: ... sections were incubated with DAPI (4′,6-diamidino-2-phenylindole dihydrochloride, Roche, 1:250 dilution) for 10 sec and washed in PBS.
-
bioRxiv - Microbiology 2023Quote: ... The cells were then washed 4 times in wash buffer containing 25% formamide (Roche, 11814320001), 2x SSC (Ambion ...
-
bioRxiv - Neuroscience 2023Quote: ... and visualized after incubation with substrate solution containing NBT (4-nitro blue tetrazolium, Roche 11383213001) and BCIP (5-bromo-4-chloro-3-indolyl-phosphate ...
-
bioRxiv - Developmental Biology 2022Quote: ... The sections were deparaffinized and rehydrated before digestion with proteinase K (4 μg/ml; Roche) for 15 min at 37℃ ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cells were subsequently fixed with 4% paraformaldehyde (PFA) and labelled with TUNEL (Roche, cat# 11684795910). Cells were then immunostained (1:2000 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.17 mg/mL 5-bromo-4-chloro-3-indolyl-phosphate (BCIP; Roche, Basel, Switzerland) at room temperature for 1 h (Brn3acKOAP/cKOAP mice ...
-
bioRxiv - Developmental Biology 2023Quote: ... rehydrated in PBST and bleached in formamide bleaching solution (4 hours) (5% formamide - Roche 11814320001), and 1.2% hydrogen peroxide (Sigma H1009) ...
-
bioRxiv - Biochemistry 2023Quote: ... diluted in 100 mM ammonium acetate (pH = 4) and digested with Glu-C protease (Roche) at 10:1 protein:enzyme for 1 h at room temperature prior to mass spectrometric analysis ...
-
bioRxiv - Developmental Biology 2023Quote: ... embryos were fixed in freshly made 4% PFA in PBS with PhosSTOP™(Roche, 4906845001) overnight at 4°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cell nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, 1 μg/mL, Roche). To reduce autofluorescence ...
-
bioRxiv - Neuroscience 2024Quote: ... incubated with anti-DIG-POD antibody (Roche; 1:1000 in TNB; 12 hr, 4 °C), and washed in TNT (3 × 20 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nuclear pellets were washed once with 4′,6-Diamidine-2′-phenylindole dihydrochloride (DAPI) (Roche, 10236276001) in methanol (1 μg/ml) ...
-
bioRxiv - Cell Biology 2024Quote: ... Sections were incubated overnight at 4°C with Anti-Digoxigenin-AP antibody (1:2000, Roche) in blocking solution ...
-
bioRxiv - Neuroscience 2024Quote: ... and incubated overnight at 4°C in horseradish peroxidase-coupled anti-DIG antiserum (11207733910, Roche) diluted 1:500 in blocking solution ...
-
bioRxiv - Molecular Biology 2022Quote: In vitro transcribed RNA was prepared from linearized plasmid containing the human PTH 3’-UTR (68) using a Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... kidney (human primary renal proximal tubule epithelial cells, RPTEC) and liver (human hepatocellular carcinoma, HepG2) cells were assessed using a standard WST-1 (Roche) cell viability assay ...
-
bioRxiv - Microbiology 2020Quote: Damage to the human colon epithelial cell line HT-29 was assessed using a lactate dehydrogenase (LDH) cytotoxicity detection kitPLUS (Roche), which measures the release of the LDH enzyme in the growth medium ...