Labshake search
Citations for Roche :
151 - 200 of 1519 citations for Glycine N Fmoc 2 13C 99%;15N 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... and 30U/ml hIL-2 (Roche). After 2 days ...
-
bioRxiv - Plant Biology 2019Quote: ... 2 tablets Protease Inhibitor Cocktail (Roche) was added and cells were disrupted using an EmulsiFlex-C3 (Avestin) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of DNase I (Roche), and 1 μl of RNase OUT (ThermoFisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... 2 mg/ml collagenase D (Roche), and 1.5 mg/ml DNase I (Roche ...
-
bioRxiv - Biophysics 2021Quote: ... 2 μg ml−1 DNaseI (Roche), and protease inhibitor cocktail (Sigma) ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 protease inhibitor cocktail tablets (Roche) per 100 mL] ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 protease inhibitor cocktail tablets (Roche) per 100 mL solution] at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... we used 2% Blocking Reagent (Roche) in PBS with 0.1% Tween-20 ...
-
bioRxiv - Immunology 2020Quote: ... + 2 U/mL DNAse I (Roche), shaking at 200 rpm for 45 mins – 1 hour at 37 °C ...
-
The transcription factor RUNX2 drives the generation of human NK cells and promotes tissue residencybioRxiv - Immunology 2022Quote: ... collagenase D (2 mg/mL, Roche) and Dnase I (0.2 mg/mL ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2% BSA fraction V (Roche Diagnostics), 10 mM nicotinamide (Calbiochem) ...
-
bioRxiv - Developmental Biology 2019Quote: ... 2% bovine serum albumin (BSA; Roche), 0.56 mg/mL transferrin (Sigma Aldrich) ...
-
bioRxiv - Developmental Biology 2020Quote: ... in 2% blocking solution (Roche 11096176001) were used for RNA probe detection ...
-
bioRxiv - Immunology 2019Quote: ... + 2 U/mL DNAse I (Roche), shaking at 200 rpm for 45 mins - 1 hour at 37 °C ...
-
bioRxiv - Physiology 2019Quote: ... 2% BSA fraction V (Roche Diagnostics), 50 μM 2-mercaptoethanol ...
-
bioRxiv - Immunology 2021Quote: ... 2 mg/mL collagenase A (Roche), and 2 mg/mL collagenase D (Roche) ...
-
bioRxiv - Immunology 2022Quote: ... IL-2 (50 IU/ml) (Roche) and glucose (Sigma) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2× complete protease inhibitor cocktail (Roche, Sigma/Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... 2 mg/mL Collagenase VIII (Roche) and 0.5 mg/mL DNAse I (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 cOmplete protease inhibitor tablets (Roche), 1 phosSTOP phosphatase inhibitor tablet (Roche) ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 “Complete” protease inhibitor tablets (Roche), 25 μg/mL lysozyme (Gold Biochem ...
-
bioRxiv - Genetics 2023Quote: ... and 2% protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 μg of DNase I (Roche) treated RNA was converted to cDNA using BioScript Reverse Transcriptase (Bioline ...
-
bioRxiv - Microbiology 2020Quote: ... Southern blotting was carried out using Hybond-N+ membrane (Amersham) and DIG High Prime DNA Labeling and Detection Starter kit II (Roche), following the indications of the manufacturer ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Cell Biology 2020Quote: Cells were pelleted and lysed with 1.5% n-dodecyl-D-maltoside (DDM) in PBS with cOmplete™ protease inhibitor (Roche) for 15 min on ice ...
-
bioRxiv - Genetics 2021Quote: ... and Tvrm323 mice (n = 4) eyes at one month of age were dissected in ice- cold PBS with proteinase inhibitor (Roche) and snap frozen in eppendorf tubes on dry ice.
-
bioRxiv - Molecular Biology 2021Quote: ... lysate supernatant from cells expressing N-terminal 6-His-tagged proteins were incubated with nickel-nitrilotriacetic acid (Ni-NTA) cOmplete His-tag purification resin (Roche) for 1 h at 4° C ...
-
bioRxiv - Cell Biology 2019Quote: ... ground yeast powder was solubilized in 4 volumes of homogenization buffer (400 mM trisodium citrate, pH 8, 0.5% n-Dodecyl β-D-maltoside) and protease inhibitor cocktail (Roche). The soluble fraction was incubated with 10 μl magnetic beads (Dynabeads ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were seeded subconfluently o/n (unless indicated otherwise) onto coverslips acid-washed and coated with human fibronectin (25 μg/ml, #11051407001, Roche), as described (Dimchev and Rottner ...
-
bioRxiv - Immunology 2020Quote: ... The treated samples were purified using a C18 cartridge (Oasis HLB Plus Waters) prior to the release of N-glycans by PNGase F (recombinant from Escherichia coli, Roche) digestion ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were then washed with PBS and lysed in HEPES buffer supplemented 100 μM N-ethylmaleimide and protease inhibitor cocktail (Roche). The lysates were centrifuged and incubated with 2 μg Mcl-1 antibody (S-19 ...
-
bioRxiv - Immunology 2022Quote: ... and 11-week infected half brains and liver lobes of mice (n=4/group) was extracted and purified using a High Pure PCR Template Prep Kit (Roche). DNA concentration of each sample was determined via NanoDrop ...
-
bioRxiv - Biochemistry 2023Quote: ... or HT alone and 0.001 μg/well N-terminally NL-tagged CCT5 and MAGEA3 (FL or -EE degrons) using X-tremeGene HP transfection reagent (Roche), following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... RPE1 cells were transfected with PB-Tet-LAP-MAP3K1 and PB-Transposase plasmid (kindly provided by N. Dimitrova) using X-tremeGENE9 reagent (Roche) and after 48 hours cells were selected with G418 ...
-
bioRxiv - Developmental Biology 2024Quote: ... were pre-washed in 0.25%BSA/DPBS and resuspended in 1ml of L3 sonication buffer (10mM TrisCl pH 8.0, 100mM NaCl, 1mM EDTA, 0.5mM EGTA, 0.1% Na-Deoxycholate, 0.5% N-Laroylsarcosine, filtered and with Roche Protease Inhibitor #04693159001) with 1% Triton ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 20 mM HEPES) supplied with 30 U/ml of human recombinant IL-2 (rIL-2, Roche). Four domains of SUPT16H ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were fixed with 2% paraformaldehyde/ 2% sucrose for 20 min and stained with DAPI (#10236276001, Roche) to visualize anaphases ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were resuspended in complete media plus 10 IU/mL recombinant human IL-2 (rHIL-2, Roche), and seeded in fresh media at 0.5×106 cells/mL every 48 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... Pellets were resuspended in 120 μl lysis buffer (0.1 M NaOH, 0.05M EDTA, 2% SDS, 2% beta-mercaptoethanol, PhosStop (Roche), cOmplete protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Cell Biology 2021Quote: ... 350 mM NaCl, 2 mM MgOAc, 1 mM CaCl2, 15% glycerol, 0.1% Triton X-100, 0.05% 2-ME, 1x Roche protease inhibitors ...
-
bioRxiv - Cell Biology 2019Quote: ... 20 mM HEPES pH 7.4 with 2 mM 2-mercaptoethanol and EDTA-free cOmplete protease inhibitor tablets (Roche) prior to lysis by probe sonication ...
-
bioRxiv - Cell Biology 2019Quote: ... 20 mM HEPES pH 7.4 with 2 mM 2-mercaptoethanol and EDTA-free cOmplete protease inhibitor tablets (Roche) prior to lysis by probe sonication ...
-
bioRxiv - Cell Biology 2019Quote: ... hypervirulent M.tb infected and uninfected macrophages using calibrated normalised relative quantities using the equation N = N0 x 2Cp (LightCycler®96 software, Roche). All qPCRs were done on RNA extracted from three separate experiments ...
-
bioRxiv - Developmental Biology 2021Quote: ... FISH signal was developed with tyramide reaction following O/N incubation of embryos in sheep anti-DIG antibody (Roche; Cat#11222089001) (1:1000 ...
-
bioRxiv - Immunology 2021Quote: ... incubated over-night (o/n) at 4°C with primary antibody diluted 1:500 in 5% Bovine Serum Albumin Fraction V (Roche 10735086001) in TBS-T ...
-
bioRxiv - Plant Biology 2022Quote: ... The products then transferred from the gel to Hybond N+ Nylon membrane (Amersham Biosciences) and detected using DIG Nucleic Acid Detection Kit (Roche Diagnostics) according to manufacturer’s protocol.
-
bioRxiv - Plant Biology 2022Quote: ... The products were then transferred from the gel to the Hybond N+ Nylon membrane (Amersham Biosciences) and detected using DIG Nucleic Acid Detection Kit (Roche Diagnostics), according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2023Quote: ... total RNA (50 μg) was separated on 1% agarose–formaldehyde gels and transferred to Hybond-N+ nylon membranes (Roche, Basel, Switzerland). Northern blotting was conducted with biotin-labeled DNA (bio-CTGTAGAAAGTCTGCTGATCGATACCGCGACG ...
-
bioRxiv - Neuroscience 2023Quote: ... prior to transfection with 2 μg pcDNA3.1 encoding N-terminally HA-tagged human 1N3R tau or 1N4R tau (14) using X-tremeGENE 9 (Roche Life Sciences), following the manufacturer’s instructions ...