Labshake search
Citations for Roche :
1 - 50 of 852 citations for GAD65 B78 Human Monoclonal Alexa488 labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...
-
bioRxiv - Cancer Biology 2023Quote: ... human PR rabbit monoclonal antibody (Roche Diagnostics, 790-4296), and human Ki67 rabbit monoclonal antibody (Roche Diagnostics ...
-
bioRxiv - Cancer Biology 2023Quote: ... and human Ki67 rabbit monoclonal antibody (Roche Diagnostics, 790-4286). Images were captured with VENTANA iScan HT (Roche Diagnostics ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled probes were detected using mouse monoclonal anti-DIG primary antibody (Roche; 1:100 dilution) and a Cy3-labeled goat anti-mouse IgG secondary antibody (Roche ...
-
bioRxiv - Molecular Biology 2019Quote: ... and mouse monoclonal antibody against the human P16 protein (Ventana Roche-E6H4, USA) was used in the immunostaining assay.
-
bioRxiv - Neuroscience 2020Quote: ... The RNA probes complementary to human METTL7B cDNA (NM_152637.2) were labeled with digoxigenin-UTP (Roche). After acetylation ...
-
bioRxiv - Cancer Biology 2021Quote: ... 50 ng of labeled probe was mixed with 10 μg of human Cot-1 DNA (Roche) and 10 μg each of salmon sperm DNA and E ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primary antibodies used for the immunostaining include human ERα rabbit monoclonal antibody (Roche Diagnostics, 790-4325), human PR rabbit monoclonal antibody (Roche Diagnostics ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and were then stained with the mouse monoclonal antibody against the human P16 protein (Ventana Roche-E6H4, USA) and the FITC-tagged secondary antibody ...
-
bioRxiv - Genomics 2020Quote: ... DIG-labeled (Roche 11218590910) was used as marker ...
-
bioRxiv - Genomics 2020Quote: ... DIG-labeled (Roche 11218590910) was used as marker for all Southern blot experiments.
-
bioRxiv - Genetics 2022Quote: ... DIG-labeled (Roche 11218590910) was used as the marker.
-
bioRxiv - Developmental Biology 2021Quote: ... Positive clones were digested with the appropriate enzyme to linearize the plasmid and anti-sense ribonucleoprobe synthesis was carried out using Sp6 or T7 RNA polymerase (New England Biolabs)+DIG labeled UTP (Roche). Subsequent probes were cleaned up using the RNA Clean Up kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were then cultured with 2 μg/ml of plate-bound anti-CD3 and anti-CD28 monoclonal antibodies (αCD3αCD28 stimulation) (mAbs) (eBioscience) and 25 U/ml of recombinant human interleukin-2 (IL-2; Roche Applied Science) at a concentration of 1.5-2 × 106 cells/ml in RPMI supplemented with 10% heat-inactivated Human Serum (HS ...
-
bioRxiv - Cancer Biology 2021Quote: ... paraffin-embedded human intestinal tissues was carried out on a Discovery Ultra automated slide stainer using a rabbit anti-human monoclonal antibody for CEA (Clone T84.66, Roche Glycart AG, Switzerland) at 2.23 µg/ml after antigen retrieval with Cell Conditioning 1 (CC1 ...
-
bioRxiv - Biochemistry 2019Quote: ... with 35S-labeled methionine (Roche). In vitro translated target proteins were incubated with Flag-tagged Swi6 at 4 °C for 20 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... with Digoxin-labeled Uridine (Roche) and other reagents according to the instructions for T7 RNA polymerase ...
-
bioRxiv - Biochemistry 2021Quote: Digoxygenin-labeled RNA probes (Roche) were generated by in vitro transcription from plasmids containing fragments of murine Shh and Sox9 ...
-
bioRxiv - Plant Biology 2022Quote: ... Digoxigenin (DIG)-labeled NTP (Roche) was integrated into antisense and sense probes during in vitro transcription by T7 polymerase (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and labeled with digoxigenin (Roche). In situ hybridization was performed as previously described (Piacentino et al. ...
-
bioRxiv - Plant Biology 2022Quote: ... Digoxigenin (DIG)-labeled NTP (Roche) was used to label antisense and sense probes generated by T7 polymerase (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... rat monoclonal (11867431001, Roche). Rabbit polyclonal antibodies specific for ZO-2 and ZO-1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Biotin-labeled SRSF5 (Bio-SRSF5) was transcribed in vitro with biotin-RNA-labeled mixture (Roche) and T7 RNA polymerase (Promega) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and digoxigenin (DIG)-labeled dNTPs (Roche) as per manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... and labeled with digoxigenin (Roche, 11175025910). Hybridization was performed with 1 to 5 μg/ml cRNA probes at 65 °C for 20 to 24 h ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... labeled with digoxigenin-11-dUTP (Roche) was used to localize 35S rDNA sites.
-
bioRxiv - Developmental Biology 2020Quote: ... with Biotin pre-labeled Uridine (Roche) and other reagents according to protocol for T7 RNA polymerase ...
-
bioRxiv - Developmental Biology 2019Quote: ... and digoxigenin (DIG)-labeled NTPs (Roche) were used ...
-
bioRxiv - Neuroscience 2023Quote: ... and Digoxygenin (DIG) labeled dNTP’s (Roche), the resultant RNA cyp19a1 probe was then used for ISH.
-
bioRxiv - Developmental Biology 2023Quote: ... and digoxigenin (DIG)-labeled nucleotides (Roche). In situ hybridization was performed on wildtype and post-electroporation HH11-15 chicken embryos ...
-
bioRxiv - Molecular Biology 2024Quote: ... nuclei were labeled with DAPI (Roche). Immunofluorescence images were acquired using the Zeiss LSM700 confocal microscope with ZEN 2010 software.
-
bioRxiv - Neuroscience 2023Quote: ... antisense digoxigenin (DIG)-labeled riboprobes (Roche) were transcribed with SP6 or T7 RNA polymerase (NEB) ...
-
bioRxiv - Cell Biology 2021Quote: ... rat monoclonal anti-HA (Roche), mouse anti-myc (New England Biolabs) ...
-
bioRxiv - Cell Biology 2021Quote: ... monoclonal anti-GFP antibody (Roche) and polyclonal antibody raised against Erg6 (kind gift from G ...
-
bioRxiv - Cell Biology 2022Quote: ... monoclonal anti-HA (3F10, Roche), and monoclonal anti-tubulin (DM1A ...
-
bioRxiv - Plant Biology 2022Quote: ... and anti-GFP (Roche; monoclonal) antibodies were used to evaluate the abundance of PM H+-ATPase ...
-
bioRxiv - Cell Biology 2024Quote: ... The membrane was blotted with anti-GFP monoclonal primary antibody (mouse monoclonal, Sigma- Roche #11814460001) at 4°C overnight ...
-
bioRxiv - Developmental Biology 2022Quote: ... mRNA probes labeled with digoxigenin-UTP (Roche) were synthesized from 1 μg of the above PCR product using the ampliCapTM SP6 high-yield message marker kit (Cell Script).
-
bioRxiv - Molecular Biology 2020Quote: ... Digoxygenin (DIG)-labeled DNA probes (Roche, Germany) were generated by PCR according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... and screened it using DIG-labeled (Roche) PCR probes to the center of the FLC locus (primers 5’ AGTGTAACTTCAATGGCAGAAAACCCT 3’ and 5’ ATGTGGCGGTAAGCAGAGATGACC 3’) ...
-
bioRxiv - Neuroscience 2020Quote: ... and digoxygenin- or fluorescein-labeled nucleotides (Roche), and hydrolyzed to around 500 bp if needed ...
-
bioRxiv - Genomics 2019Quote: ... Digoxigenin (DIG) labeled nucleotides (Roche, Basel, Switzerland) were used to create amplified sequences with DIG labeled base pairs ...
-
bioRxiv - Developmental Biology 2023Quote: ... and digoxigenin or fluorescein labeled nucleotides (Roche). In situ hybridization was carried out using standard protocols (74) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and digoxigenin (DIG)-labeled NTPs (11277073910, Roche) as per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Tagged SAC9 fusion proteins were revealed by using GFP monoclonal antibody (anti-GFP mouse monoclonal, Roche) and detected by chemiluminescence using ECL revelation as for T-PLATE and SH3P2 fusion proteins.
-
bioRxiv - Neuroscience 2022Quote: ... Digoxigenin (DIG)-labeled or fluorescein (FITC)-labeled riboprobes were synthesized with T7 or T3 or SP6 RNA polymerase (Roche) from the linearized plasmids with DIG or FITC RNA labeling mix (Roche) ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-GFP (Roche, 11814460001); mouse monoclonal anti-c-myc 9E10 (Roche ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-HA epitope rat monoclonal (Roche) 1:1000 ...
-
bioRxiv - Microbiology 2021Quote: ... Rat monoclonal antibody (clone 3F10, Roche) was used to detect HA-tagged proteins ...