Labshake search
Citations for Roche :
101 - 150 of 6226 citations for Epiandrosterone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... ITS (5 μg/mL insulin, 5 μg/mL transferrin and 5 ng/mL sodium selenite; Roche Diagnostics GmbH), and 5 % fetal bovine serum (FBS ...
-
bioRxiv - Biophysics 2021Quote: ... The troponin T detection kit (Elecsys® Troponin T Gen 5 STAT) and troponin T were purchased from Roche. 1X phosphate-buffered saline (PBS ...
-
bioRxiv - Cell Biology 2020Quote: RACE-cDNA was synthesized according to the manufacturer’s protocol for 5’/3’ RACE Kit 2nd generation (Roche; Cat.No. 03353621001). The 2648-bp cDNA was cloned into the NheI-XhoI site in pcDNA 3.1 plasmid to obtain pcDNA3.1-DR5-AS and was verified by sequencing ...
-
bioRxiv - Molecular Biology 2019Quote: ... up to 5 ng/sample of ChIP was prepared for sequencing using the Kapa Hyper-prep Kit (Kapa Biosystems) using NEXTflex adapters (Bio Scientific) ...
-
bioRxiv - Physiology 2023Quote: ... according to the manufacturer’s protocol and were transcribed into cDNA with the 2nd generation 5’/3’ RACE Kit (Roche) in combination with the Expand High Fidelity PCR System (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... two PCR reactions were performed with PCR anchor primer (included in the 2nd Generation 5’/3’ RACE Kit, Roche) and GB3 (oligo 61 ...
-
bioRxiv - Genomics 2023Quote: ... Library construction was performed on the 5 ng of pooled PCR amplicons using the KAPA HyperPrep Kit (Roche 07962363001) and NEXTFLEX Unique Dual Index Barcodes (7.5µM final concentration ...
-
bioRxiv - Neuroscience 2023Quote: ... cells and sections were processed for BrdU immunodetection following the manufacturer’s recommendations (5-Bromo-2′-deoxy- uridine Labelling and Detection Kit I, Roche). The slides were mounted for fluorescent microscopy in ProLong® Diamond Antifade Mountant with DAPI (Life Technologies).
-
bioRxiv - Neuroscience 2024Quote: ... 5-diphenyl tetrazolium bromide (MTT) in accordance with the manufacturer’s recommendations (Cell Proliferation Kit I; Roche Diagnostics, Basel, Switzerland). In brief ...
-
bioRxiv - Microbiology 2024Quote: ... qPCR reactions were performed in 384-well plates (LightCycler 480 Multiwell Plates 384, white, Roche Diagnostics) on the Light Cycler 480 II instrument (Roche Diagnostics).
-
bioRxiv - Immunology 2021Quote: ... and 384-Well Reaction Plates (Roche). Primer sequences are as follows:
-
bioRxiv - Microbiology 2023Quote: ... using Lightcycler 480 multiwell plates (Roche) and Luna Universial qPCR Master Mix (NEB ...
-
bioRxiv - Microbiology 2019Quote: ... RNA transcripts of the cloned 5’UTRB7 fragments were produced in vitro from the resulting purified PCR products by using the T7 Transcription kit (Roche) and labeled by using the RNA 3’ end biotinylation kit (Pierce) ...
-
bioRxiv - Genomics 2019Quote: ... The supernatants from the digestion and initial decalcification step were purified using a 5 M guanidine-hydrochloride binding buffer with a High Pure Viral Nucleic Acid Large Volume kit (Roche). The extract was eluted in 100 μl of a 10mM tris-hydrochloride ...
-
bioRxiv - Genomics 2019Quote: ... 5 ng DNA fragments were pooled and proceeded on with library construction using KAPA Hyper Prep Kit (Kapa Biosystems #KK8504) according to the standard protocol ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was extracted from 58 macro-dissected regions of slides G1-5 in samples UH1-UH16 and 30 regions of slides F1-5 in samples UH17-UH23 and UH25-UH27 (Supplementary Table 2) using the High Pure FFPE RNA isolation kit (Roche). For UH4 ...
-
bioRxiv - Biochemistry 2022Quote: ... samples were incubated with 50 μl mix of 5 μl enzyme and 45 μl labeling solution (TUNEL In situ Cell Death Detection Kit, TMR Red’ from Roche) for 1.5 h at 37°C in a dark humid chamber ...
-
bioRxiv - Genetics 2019Quote: ... located in exon 18 and reverse primer 5’-TTGGTGGCTACAAAGACGTG-3’ located in exon 22 using the One Tube reverse transcription-PCR reaction kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: Total DNA was isolated from L3 larvae or 5-days old adults of Iduna homozygous mutants and control sequencing strain using the Roche genomic DNA extraction kit (Roche). To confirm the mutant line ...
-
bioRxiv - Developmental Biology 2021Quote: Pitx1 WISH were performed on 40-45 somite stage mouse embryos (E12.5) using a digoxigenin-labeled Pitx1 antisense riboprobe transcribed from a cloned Pitx1 probe (PCR DIG Probe Synthesis Kit, Roche), as previously described in (Kragesteen et al ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2-10 5 micron sections were extracted using the High Pure FFPE RNA Isolation kit (Roche Life Sciences, Penzberg, Germany) under RNase free conditions following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... Fluorophores with the least autofluorescence on FFPE tissue were selected to minimize false positives: Cyanine 5 (Cy5) (DISCOVERY CY5 Kit, Cat#760238, Roche Diagnostics Corporation ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5% blocking reagent (Roche) containing 2.5 μg ml-1 Cy-3-labelled telomere specific (CCCTAA ...
-
bioRxiv - Physiology 2023Quote: ... 5% blocking reagent (Roche), with 1.0 μg/mL of Cy3-labeled telomere-specific (CCCTAA ...
-
bioRxiv - Cell Biology 2023Quote: ... X100)/5% BSA (Roche, 10735086001) for 1 hour at RT ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% glycerol and 5 mM imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% glycerol and 5 mM imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% glycerol and 5 mM imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% glycerol and 5 mM Imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% glycerol and 5 mM imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% glycerol and 5 mM Imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% glycerol and 5 mM imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Developmental Biology 2021Quote: ... Planarians were blocked in Blocking Solution (5% heat inactivated horse serum, 5% Roche Western Blocking Buffer in TNTx [0.1 M Tris pH 7.5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... transferrin (5 μg/mL) and sodium selenite (5 ng/mL) (Roche Diagnostics, Germany), 100 units/mL of penicillin ...
-
bioRxiv - Developmental Biology 2023Quote: ... Planarians were blocked in Blocking Solution (5% heat inactivated horse serum, 5% Roche Western Blocking Buffer in TNTx [0.1 M Tris pH 7.5 ...
-
bioRxiv - Cell Biology 2022Quote: ... HUVEC were seeded to confluency on the microelectrodes of the E-plate (E-plate 16, Roche Applied Science). Electrical impedance readings were taken every 2 min for 5h ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% CO2 by quantification of LDH released into cell supernatants by apoptotic/necrotic cells (LDH detection kit, Roche Applied Science, #11644793001). Maximal lysis of the target cells (= 100% ...
-
bioRxiv - Cancer Biology 2020Quote: Cell (1 × 104) proliferation was measured using the 5-Bromo-2′-deoxy-uridine Labeling and Detection Kit III (Roche, Mannheim, Germany) (Jin ...
-
bioRxiv - Microbiology 2021Quote: ... Ten nanograms of cDNA were used as a template in a 5- l reaction mixture from a KAPA SYBR FAST qPCR kit (Kapa Biosystems). Primers used are listed in table S3 ...
-
bioRxiv - Microbiology 2022Quote: Ten nanograms of cDNA were used as a template in a 5 μl reaction mixture from a KAPA SYBR FAST qPCR kit (Kapa Biosystems). Primers used are listed in Table S2 ...
-
bioRxiv - Immunology 2022Quote: ... and a primer complementary to the template-switch adapter (5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAAGCAGTGGTATCAACGCAG, adapter in italic) with the KAPA Real-Time Library Amplification Kit (Kapa Biosystems). Adapters were required for subsequent sequencing reactions ...
-
bioRxiv - Cancer Biology 2023Quote: ... in addition to qPCR on the Applied Biosystems QuantStudio 5 Real-Time PCR System using the Roche KAPA Library Quantification Kit (Roche, KK4824) to determine the concentration of adapter-ligated libraries ...
-
bioRxiv - Genomics 2023Quote: ... and Illumina PCR-free libraries were prepared from 700 ng DNA using the KAPA Hyper prep kit and unique dual-indexed adapters (5 µL of a 15 µM stock) according to the supplier’s protocol (Roche, Basel, Switzerland). The library concentration and size distribution were assessed on a Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 ng of DNA from each sample was analyzed using the Kapa Cyber Fast Q-PCR Kit (Kapa Biosystems, Wilmington, MA). The following rDNA primers (designed using Primer3Plus software ...
-
bioRxiv - Neuroscience 2024Quote: ... 5’-ATGGGCACCCAAAACAACAGT-3’ and 5’-GCGGCAGCACATATCCAAAAA-3’) was PCR amplified with a fast-cycling polymerase (KAPA2G Fast HotStart PCR kit, KAPA Biosystems) and a subsequent gel-electrophoresis ...
-
bioRxiv - Developmental Biology 2022Quote: ... The incorporation of BrdU was then measured by ELISA at 24h per the manufacturer’s protocol (Roche Diagnostics, Mannheim, Germany).
-
bioRxiv - Neuroscience 2020Quote: ... 40 mM KCl, 5 mM EGTA, 5 mM MgCl2, 5 mM DTT, 1 mM PMSF, 1% Triton X, protease inhibitor Roche complete, pH 7.2) and sonicated at low power for 5 s ...
-
bioRxiv - Biochemistry 2021Quote: ... The pellets of harvested bacteria were resuspended in 5 mL of lysis buffer (20mM NaP pH 7.5, 300mM NaCl, 15mM imidazole, 5% glycerol, 0.5mM TCEP, 1 mg/ml lysozyme, 5 U/ml DNase, 1 Roche protease inhibitor tablet/100mL) per 1 g of wet weight culture ...
-
bioRxiv - Biochemistry 2021Quote: ... The pellets were resuspended in 5 mL of lysis buffer (20mM NaP pH 7.5, 300mM NaCl, 15mM imidazole, 5% glycerol, 0.5mM TCEP, 1 mg/ml lysozyme, 5 U/ml DNase, 1 Roche protease inhibitor tablet/100mL) per 1 g of wet weight culture ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were blocked in 5% non-fat milk or 5% Casein (Roche Diagnostics) in Tris-buffered saline with 0.1% Tween (TBS-T ...