Labshake search
Citations for Roche :
351 - 400 of 3919 citations for Diazinon Unlabeled 1000 Ug Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... 100ug/ml DNase I (Roche) and 2 mM CaCl2 for 30 min at 37 °C ...
-
bioRxiv - Genomics 2020Quote: ... 40µg/mL DNase I (Roche)) for 1h at 37°C under constant agitation ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.25 mg/ml lysozyme (Roche), EDTA-free protease inhibitor (Roche) ...
-
bioRxiv - Immunology 2021Quote: ... and 0.4mg/ml DNaseI (Roche) in HBSS plus 5% fetal bovine serum and 10mM HEPES ...
-
bioRxiv - Immunology 2021Quote: ... and 50ug/ml Liberase (Roche). Thymi were digested in 37°C water bath with mechanical aid by pipetting through a glass Pasteur pipette every 4 minutes ...
-
bioRxiv - Immunology 2021Quote: ... with 100ug/ml DNase (Roche) and 50ug/ml Liberase (Roche) ...
-
bioRxiv - Immunology 2021Quote: ... with 100ug/ml DNase (Roche) and 50ug/ml Liberase (Roche) ...
-
bioRxiv - Immunology 2020Quote: ... 50 μg/ml DNaseI (Roche), and 0.1% (wt/vol ...
-
bioRxiv - Immunology 2020Quote: ... 1mg/ml collagenase A (Roche) and 0.4mg/ml DNase I (Sigma ...
-
bioRxiv - Bioengineering 2022Quote: ... transferrin (150□mg/ml, ROCHE), ascorbic acid (50□mg/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... or hygromycin (125ug/mL, Roche). Neural monolayer differentiation was performed as outlined in (Ying et al. ...
-
bioRxiv - Physiology 2022Quote: ... 10 µg/ml leupeptin (Roche), and 1 mM phenylmethylsulfonyl fluoride (PMSF ...
-
bioRxiv - Immunology 2022Quote: ... 10ng/mL TGF-β (Roche), 0,5% O2 or NaCl / KCl as indicated)..
-
bioRxiv - Synthetic Biology 2022Quote: ... 0.17 mg/mL tRNA (Roche), 0.4 mM NAD ...
-
bioRxiv - Immunology 2022Quote: ... Phytohemagglutinin (PHA, Roche; 5μg/ml) was used as a positive control ...
-
bioRxiv - Immunology 2022Quote: ... containing 0.5mg/ml DNase (Roche)) ...
-
bioRxiv - Neuroscience 2022Quote: ... Laminin 0,2 μg/ml (Roche), Culture 1 1% (Gibco) ...
-
bioRxiv - Neuroscience 2023Quote: ... BrdU (Roche, 20 ng/mL) was then added in the medium 6 hours before fixation ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 U/ml pronase (Roche) solution was added ...
-
bioRxiv - Cell Biology 2022Quote: ... the cells were seeded onto a 35 mm dish and treated with 0.5 μg/ml puromycin (Invivogen)/1 mg/ml G418 (Roche) for more than 14 days ...
-
bioRxiv - Immunology 2022Quote: ... 10 μg/ml DNAse (Roche) and 2% FBS ...
-
bioRxiv - Immunology 2022Quote: ... 10 μg/ml DNAse (Roche) and 2% FBS ...
-
bioRxiv - Cell Biology 2023Quote: ... 14 µg/mL insulin (Roche), 20 ng/mL Oncostatin M (R&D ...
-
bioRxiv - Immunology 2023Quote: ... 10µg/mL DNase I (Roche), 5mM MgCl2 ...
-
bioRxiv - Pathology 2023Quote: ... 1 mg/mL lysozyme (Roche). Lysate was allowed to settle for 30 min on ice and sonicated for 1 minute (20 second intervals on ice) ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 µg/mL transferrin (Roche), 14 µg/mL insulin (Roche) ...
-
bioRxiv - Immunology 2023Quote: ... 2 μg/ml Histon (Roche), 1 μg/ml Sm/RNP (GenWay) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 mg/mL BSA (Roche), 60 µg/mL catalase (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... RNase A (1mg/ml, Roche) in 1XPBS-for 3 hours at room temperature (RT ...
-
bioRxiv - Immunology 2023Quote: ... DNAse I 10U/mL (Roche), 5% iFCS and 10 mM HEPES ...
-
bioRxiv - Immunology 2023Quote: ... DNAse I 10U/mL (Roche), 5% iFCS and 10 mM HEPES ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 ml TriPure Reagent (Roche) was added ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.04 mg/mL catalase (Roche), 5% w/v glucose ...
-
bioRxiv - Molecular Biology 2023Quote: ... 300 mg/ml transferrin (Roche), 50 g/ml ascorbic acid ...
-
bioRxiv - Immunology 2023Quote: ... 0.2mg/ml Collagenase P (Roche) and 0.1mg/ml DNase (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... transferrin (150 mg/ml, ROCHE), ascorbic acid (50 mg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... transferrin (150 mg/ml, ROCHE), ascorbic acid (50 mg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... transferrin (150 mg/mL, ROCHE), ascorbic acid (50 mg/ml ...
-
bioRxiv - Bioengineering 2023Quote: ... 150 μg/mL transferrin (Roche), and with Matrigel (Cat#354277 ...
-
Treg cells drive MYCN-mediated immunosuppression and tumor aggressiveness in high-risk neuroblastomabioRxiv - Cancer Biology 2023Quote: ... 0.025 μg/ml Liberase (Roche), 0.6μg/ml DNase I (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μg/mL pyrophosphatase (Roche), 5 mM NTPs ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... 10 µg/ml insulin (Roche), 0.5 µg/mL hydrocortisone (Sigma) ...
-
bioRxiv - Immunology 2024Quote: ... laminin (5 µg/ml, Roche), bovine collagen I (30µg/ml ...
-
bioRxiv - Immunology 2024Quote: ... 12,5 μg/ml DNAse (Roche), and 1% FBS (Bodego ...
-
bioRxiv - Neuroscience 2024Quote: ... and DispaseII (Roche, 1mg/ml) and minced before placing on thermocycler at 37C for 1h at 1000rpm ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.2LJmg/mL DNase I (Roche) and 4% Trypsin (0.25% in Tris Saline ...
-
bioRxiv - Biophysics 2024Quote: ... 2170 U/ml catalase (Roche) and 3 mM Trolox (Sigma)) ...
-
bioRxiv - Biophysics 2024Quote: ... 2170 U/ml catalase (Roche) and 3 mM Trolox (Sigma) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5mg/ml blocking reagent (Roche), and 0.5ug/ml biotinylated LNA probe against SATII (based on the sequence ATTCCATTCAGATTCCATTCGATC (Swanson et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... 6 μg/ml Bevacizumab (Roche) was administered ...