Labshake search
Citations for Roche :
151 - 200 of 6248 citations for Corticosterone Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... located in exon 18 and reverse primer 5’-TTGGTGGCTACAAAGACGTG-3’ located in exon 22 using the One Tube reverse transcription-PCR reaction kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: Total DNA was isolated from L3 larvae or 5-days old adults of Iduna homozygous mutants and control sequencing strain using the Roche genomic DNA extraction kit (Roche). To confirm the mutant line ...
-
bioRxiv - Developmental Biology 2021Quote: Pitx1 WISH were performed on 40-45 somite stage mouse embryos (E12.5) using a digoxigenin-labeled Pitx1 antisense riboprobe transcribed from a cloned Pitx1 probe (PCR DIG Probe Synthesis Kit, Roche), as previously described in (Kragesteen et al ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2-10 5 micron sections were extracted using the High Pure FFPE RNA Isolation kit (Roche Life Sciences, Penzberg, Germany) under RNase free conditions following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... Fluorophores with the least autofluorescence on FFPE tissue were selected to minimize false positives: Cyanine 5 (Cy5) (DISCOVERY CY5 Kit, Cat#760238, Roche Diagnostics Corporation ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5% blocking reagent (Roche) containing 2.5 μg ml-1 Cy-3-labelled telomere specific (CCCTAA ...
-
bioRxiv - Cell Biology 2023Quote: ... X100)/5% BSA (Roche, 10735086001) for 1 hour at RT ...
-
bioRxiv - Physiology 2023Quote: ... 5% blocking reagent (Roche), with 1.0 μg/mL of Cy3-labeled telomere-specific (CCCTAA ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% glycerol and 5 mM imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% glycerol and 5 mM imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% glycerol and 5 mM imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% glycerol and 5 mM Imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% glycerol and 5 mM imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% glycerol and 5 mM Imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% glycerol and 5 mM imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Developmental Biology 2021Quote: ... Planarians were blocked in Blocking Solution (5% heat inactivated horse serum, 5% Roche Western Blocking Buffer in TNTx [0.1 M Tris pH 7.5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... transferrin (5 μg/mL) and sodium selenite (5 ng/mL) (Roche Diagnostics, Germany), 100 units/mL of penicillin ...
-
bioRxiv - Developmental Biology 2023Quote: ... Planarians were blocked in Blocking Solution (5% heat inactivated horse serum, 5% Roche Western Blocking Buffer in TNTx [0.1 M Tris pH 7.5 ...
-
bioRxiv - Cell Biology 2022Quote: ... HUVEC were seeded to confluency on the microelectrodes of the E-plate (E-plate 16, Roche Applied Science). Electrical impedance readings were taken every 2 min for 5h ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% CO2 by quantification of LDH released into cell supernatants by apoptotic/necrotic cells (LDH detection kit, Roche Applied Science, #11644793001). Maximal lysis of the target cells (= 100% ...
-
bioRxiv - Cancer Biology 2020Quote: Cell (1 × 104) proliferation was measured using the 5-Bromo-2′-deoxy-uridine Labeling and Detection Kit III (Roche, Mannheim, Germany) (Jin ...
-
bioRxiv - Microbiology 2021Quote: ... Ten nanograms of cDNA were used as a template in a 5- l reaction mixture from a KAPA SYBR FAST qPCR kit (Kapa Biosystems). Primers used are listed in table S3 ...
-
bioRxiv - Microbiology 2022Quote: Ten nanograms of cDNA were used as a template in a 5 μl reaction mixture from a KAPA SYBR FAST qPCR kit (Kapa Biosystems). Primers used are listed in Table S2 ...
-
bioRxiv - Immunology 2022Quote: ... and a primer complementary to the template-switch adapter (5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAAGCAGTGGTATCAACGCAG, adapter in italic) with the KAPA Real-Time Library Amplification Kit (Kapa Biosystems). Adapters were required for subsequent sequencing reactions ...
-
bioRxiv - Cancer Biology 2023Quote: ... in addition to qPCR on the Applied Biosystems QuantStudio 5 Real-Time PCR System using the Roche KAPA Library Quantification Kit (Roche, KK4824) to determine the concentration of adapter-ligated libraries ...
-
bioRxiv - Genomics 2023Quote: ... and Illumina PCR-free libraries were prepared from 700 ng DNA using the KAPA Hyper prep kit and unique dual-indexed adapters (5 µL of a 15 µM stock) according to the supplier’s protocol (Roche, Basel, Switzerland). The library concentration and size distribution were assessed on a Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 ng of DNA from each sample was analyzed using the Kapa Cyber Fast Q-PCR Kit (Kapa Biosystems, Wilmington, MA). The following rDNA primers (designed using Primer3Plus software ...
-
bioRxiv - Neuroscience 2024Quote: ... 5’-ATGGGCACCCAAAACAACAGT-3’ and 5’-GCGGCAGCACATATCCAAAAA-3’) was PCR amplified with a fast-cycling polymerase (KAPA2G Fast HotStart PCR kit, KAPA Biosystems) and a subsequent gel-electrophoresis ...
-
bioRxiv - Developmental Biology 2022Quote: ... The incorporation of BrdU was then measured by ELISA at 24h per the manufacturer’s protocol (Roche Diagnostics, Mannheim, Germany).
-
bioRxiv - Neuroscience 2020Quote: ... 40 mM KCl, 5 mM EGTA, 5 mM MgCl2, 5 mM DTT, 1 mM PMSF, 1% Triton X, protease inhibitor Roche complete, pH 7.2) and sonicated at low power for 5 s ...
-
bioRxiv - Biochemistry 2021Quote: ... The pellets of harvested bacteria were resuspended in 5 mL of lysis buffer (20mM NaP pH 7.5, 300mM NaCl, 15mM imidazole, 5% glycerol, 0.5mM TCEP, 1 mg/ml lysozyme, 5 U/ml DNase, 1 Roche protease inhibitor tablet/100mL) per 1 g of wet weight culture ...
-
bioRxiv - Biochemistry 2021Quote: ... The pellets were resuspended in 5 mL of lysis buffer (20mM NaP pH 7.5, 300mM NaCl, 15mM imidazole, 5% glycerol, 0.5mM TCEP, 1 mg/ml lysozyme, 5 U/ml DNase, 1 Roche protease inhibitor tablet/100mL) per 1 g of wet weight culture ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were blocked in 5% non-fat milk or 5% Casein (Roche Diagnostics) in Tris-buffered saline with 0.1% Tween (TBS-T ...
-
bioRxiv - Developmental Biology 2023Quote: ... HUVEC were seeded at a density of 60,000cells/well of the E-plate (E-plate 16, Roche Applied Science), then electrical impedance readings acquired every 2 min for 24 hr ...
-
bioRxiv - Cell Biology 2023Quote: ... The plate was briefly pulsed in the centrifuge and sealed with a clear PCR plate seal (Roche Life Science). The LightCycler® instrument (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5% blocking reagent (Roche, Germany)] containing 2.5 μg/mlCy-3-labelled telomere-specific (CCCTAA ...
-
bioRxiv - Neuroscience 2020Quote: ... including 5% WesternBlocking Solution (Roche) overnight at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL SYBR green (Roche), 1 μL 10 mM of both forward and reverse primer (see Table S3 for primer sequences ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL SYBR green (Roche), 1 μL 10 mM of both forward and reverse primer and 15 ng gDNA was mixed in a 10 μL reaction volume and loaded in a white qPCR plate with optical caps (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... midazolam (5 mg/kg, Roche) and medetomidine (0.5 mg/kg ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 µg DNase I (Roche) and 1x complete Protease Inhibitor Cocktail (Roche) ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 mM DTT (Roche, 10708984001), 0.1 mM EDTA (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 mM DTT (Roche, 10708984001), 0.1 mM EDTA (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM Tris (Roche, 107089176009), pH 7.4) ...
-
bioRxiv - Immunology 2024Quote: ... laminin (5 µg/ml, Roche), bovine collagen I (30µg/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 μg glycogen (Roche #10901393001) was added per sample ...
-
bioRxiv - Cell Biology 2019Quote: ... with ATP standard solutions used at concentrations between 10−8 and 10−5 M (luciferin/luciferase ATP bioluminescence assay kit CLSII, Roche, Basel, Switzerland). Data are expressed as nmol ATP produced/min/106 cells.
-
bioRxiv - Microbiology 2022Quote: ... 0.2 μL of each primer (100mM stock) (Table SI-4) and 5 μL of 2× KAPA SYBR Fast Universal qPCR kit (KAPA Biosystems, USA). Samples were cycled (40 cycles ...
-
SARS-CoV-2 Point Mutation and Deletion Spectra, and Their Association with Different Disease OutcomebioRxiv - Microbiology 2022Quote: ... Each region was amplified from 5 μl of the RNA preparation by RT-PCR using Transcriptor One Step RT-PCR kit (Roche Applied Science). To perform the RT-PCR ...
-
bioRxiv - Developmental Biology 2019Quote: ... The samples were boiled at 95°C for 5 minutes and diluted 1:1000 in dilution buffer provided in ATP luminescence kit HSII (Roche, Cat# 11699709001). The further assay was performed as instructed by the kit’s manual in Luminometer (Promega GloMax96 Microplate Luminometer) ...