Labshake search
Citations for Roche :
201 - 250 of 6248 citations for Arg8 Vasopressin AVP Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was diluted to a final concentration of 5 ng/μl and RT–qPCR was performed with KAPA SYBR® FAST qPCR kits (KAPA Biosystems) on a C1000 thermal cycler ...
-
bioRxiv - Genetics 2021Quote: ... The T7 promoter was added to the 5’ and 3’ ends to synthesize the sense and anti-sense probes using the DIG RNA Labeling Kit (Roche, Cat# 11175025910). In situ hybridization was performed as previously described [65,66] with minor modifications ...
-
bioRxiv - Physiology 2020Quote: ... Tissues were homogenised in assay buffer provided in the kit with the addition of 5 μL of protease inhibitor cocktail (Roche, Basel Switzerland) and centrifuged at 800 × g for 10 minutes at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Femurs were then decalcified and paraffin sections (5-μm thickness) were stained with hematoxylin and eosin or reticulin (Reticulum II Staining Kit, Roche, Tucson, AZ) to assess fibrosis ...
-
bioRxiv - Immunology 2021Quote: ... it was added 50 µL of fresh TUNEL reaction mixture composed of 5 µL of enzyme solution mixed with 45 µL of labeling solution (In Situ Cell Death Detection kit, POD, ROCHE, version 15.0) for 1 hour at 37 °C ...
-
bioRxiv - Genetics 2024Quote: ... 1 mM DTT, 10 mM NaPPi, 5 mM EGTA, 5 mM EDTA, 0.1 mM Na3VO4, 5 mM NaF, and Roche cOmplete™ Protease Inhibitor Mix). Crude extracts were prepared by centrifugation ...
-
bioRxiv - Plant Biology 2023Quote: ... 5% glycerol) supplemented with 5% v/v beta mercaptoethanol and 1x protease inhibitor cocktail (Roche) was added to each sample followed by centrifugation at 18,000×g at 4 °C for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... and co-transfected into 60-70% confluent BHK cells grown in 6-well plate tissue culture plates using Fugene HD transfection reagent (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: Cells were transfected with 250-800 ng DNA per well of a 12-well plate or 500 ng per well of a 6-well plate using X-tremeGENE 9 DNA transfection reagent (Roche), and harvested after 24 h.
-
bioRxiv - Immunology 2020Quote: ... To quantify NETs we measured HNE-DNA complexes using ELISA specific for HNE and anti-DNA Ab of Cell Death Detection ELISAPLUS (Roche). Briefly ...
-
bioRxiv - Biochemistry 2020Quote: RT activity was measured using an ELISA-based colorimetric reverse transcriptase activity assay (Catalog No. 11468120910, Roche Diagnostics, Indianapolis, IN). The HEPES integration buffer was used for the reaction ...
-
bioRxiv - Cell Biology 2019Quote: ... and the RealTime ready Custom Panels plates (Roche) used for the assay ...
-
bioRxiv - Systems Biology 2019Quote: ... in 96-well plates using SYBR Green (Roche) for selected transcript sequences with two technical replicates for each of the three independent biological replicates ...
-
bioRxiv - Cancer Biology 2021Quote: ... in a Lightcycler 480 384-well plate (Roche), and analyzed using Lightcycler 480 Software v1.5 (Roche) ...
-
bioRxiv - Neuroscience 2023Quote: ... onto a LightCycler multiwell 384 white plate (Roche). 3uL of the qPCR detection master mix (Table S4 ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Microbiology 2021Quote: ... 0.2 pmoles of gene-specific forward primer and 0.2 pmoles of gene-specific reverse primer was combined with 2 µL of cDNA template into each well of a 96-well plate (LightCycler® 480 Multiwell Plate 96, white, 04729692001, Roche). qPCR amplification was performed using the following cycling conditions ...
-
bioRxiv - Genetics 2023Quote: Cell migration assays were performed with the xCELLigence Biosensor System using specifically designed 16-well plates equipped with membranes having 8-μm pores (CIM-plate 16; Roche Diagnostics). Cells in serum-free medium were seeded in the upper chambers ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 μg of trypsin (Roche, Switzerland) was added and the mixture was further incubated at 37°C overnight ...
-
bioRxiv - Immunology 2019Quote: ... and 5 tablets PhosSTOP inhibitor (Roche) per 50 mL buffer ...
-
bioRxiv - Neuroscience 2019Quote: ... dispase (5 U ml−1; Roche), and deoxyribonuclease II (50 mg ml−1 ...
-
bioRxiv - Neuroscience 2019Quote: ... 5 mg/kg midazolam (Dormicum, Roche) and 0.05 mg/kg fentanyl (Fentanyl ...
-
bioRxiv - Molecular Biology 2022Quote: ... Then 5 μl proteinase K (Roche) in 20 mg/mL stock was added and incubation was continued at 55°C for 1 hr ...
-
bioRxiv - Cell Biology 2019Quote: ... and 5 μg/ml Laminin (Roche) pre-coated #1.5 Φ12 mm round cover glass (Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μg/ml inorganic pyrophosphatase (Roche), and 1.5 u/μl of the mutant T7 RNA polymerase (T7 R&DNA polymerase ...
-
bioRxiv - Immunology 2021Quote: ... DNAse I (5 µg/ml, Roche) and 10% FBS (Sigma ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5% glycerol) supplemented with phosphatase (Roche) and protease (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 μg/mL DNaseI (Roche). For cell lysis ...
-
bioRxiv - Bioengineering 2023Quote: ... + Insulin (5 ug/mL, Roche 11376497001) + BSA (10 mg/mL ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 mg/ml collagen (Roche, 10103578001), and 15 U/ml Dispase II (Stemcell Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mg.kg-1 midazolam (Dormicum, Roche), and 0.05 mg.kg-1 fentanyl (Fentanyl ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 μg/mL phytohemagglutinin (Roche) to generate T cell blasts (29).
-
bioRxiv - Developmental Biology 2023Quote: ... 5 mg/ml collagen (Roche, 10103578001), and 15 U/ml Dispase II (Stemcell Technologies ...
-
bioRxiv - Genomics 2024Quote: ... 5 U Klenow DNA polymerase (Roche), and incubated for 30 min at RT ...
-
bioRxiv - Biochemistry 2019Quote: ... Fisher Bioreagents) (PBS-T) and re-suspended in 50 μl storage buffer (Blocking Reagent for ELISA, 11 112 589 001, Roche Diagnostics) supplemented with ProClin (4812-U ...
-
bioRxiv - Microbiology 2020Quote: IL-6 release over time was studied in the Laboratoriumsmedizin of the Munich University using an ELISA (Roche, Elecsys IL-6).
-
bioRxiv - Cell Biology 2020Quote: ... HUVEC were pre-treated with siRNAs or drug for 24 hr prior to plating an equal cell number onto the microelectrode surface of the E-plate (E-plate 16, Roche Applied Science). Impedance readings were taken automatically every 5 min for 24 hr.
-
bioRxiv - Cancer Biology 2021Quote: ... 5% CO2 by quantification of LDH released into cell supernatants by apoptotic/necrotic cells (LDH detection kit, Roche Applied Science, #11 644 793 001). Maximal lysis of the target cells (= 100% ...
-
bioRxiv - Plant Biology 2021Quote: ... was isolated from the cDNA of juvenile cluster root tissues from P-deficient plants using the 5’/3’ RACE Kit (2nd generation, Roche Diagnostics S.p.a., Monza, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR primer for generating the probe was 5’-GGTTCTGTGATTGAGTGTTTGGATCTCCCTGCG-3’ with a single-end CY3 tag generated using the DIG RNA Labeling Kit (Roche Applied Science, Penzberg, Germany) based on the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: Genomic DNA (5∼8 μg) for Nanopore sequencing was end-repaired and ligated via a KAPA Hyper Prep Kit (Cat#KR0961, Kapa Biosystems, Wilmington, MA, USA), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... 5 μL of glycogen (20 mg/ ml) and 5 μl of proteinase K (20 mg/ ml; Roche) were added to the samples and incubated at 37 °C for 2 hours ...
-
bioRxiv - Genomics 2021Quote: ... rp49 5’-TAATACGACTCACTATAGGGCAGTAAACGCGGTTCTGCATG-3’ and 5’-CAGCATACAGGCCCAAGATC-3’) were transcribed using the Biotin RNA Labeling Mix (Roche) and T7 polymerase (Promega).
-
bioRxiv - Immunology 2023Quote: ... 5 mM CaCl2 and 5 mM MgCl2 with 100× concentrated EDTA-free protease inhibitor cocktail (Roche, pallet). The suspensions were treated with Dounce and added with 25 mU ml−1 apyrase ...
-
bioRxiv - Biophysics 2019Quote: ... and loaded in LightCycler 480 Multiwell Plate 96 (Roche) for DSF assay ...
-
bioRxiv - Physiology 2022Quote: ... in a LightCycler LC480 plate reader (Roche Life Science). For each cDNA sample ...
-
bioRxiv - Microbiology 2021Quote: ... on 384-well plates using a LightCycler 480 (Roche) following manufacturer recommendations and the primers shown in Table S2 ...
-
bioRxiv - Genomics 2021Quote: ... in 384-well plates on a LightCycler480 device (Roche) as described in (Varrault et al ...
-
bioRxiv - Genetics 2022Quote: ... and LightCycler® 480 Multiwell Plate 384 (Roche, # 04729749001) were used according to the manufacturers’ recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... in 384-well plates on a LightCycler 480 (Roche) following the manufacturer’s protocol ...