Labshake search
Citations for Roche :
151 - 200 of 7048 citations for Anti CD25 SAP human Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... either SP6 or T7 RNA polymerase was used to produce a DIG (digoxigenin)-labeled RNA anti-sense probe (Roche DIG RNA Labelling Kit (SP6/T7)) ...
-
bioRxiv - Genomics 2020Quote: ... anti-GFP (Roche) and anti-L1 ...
-
bioRxiv - Microbiology 2020Quote: ... anti-HA (Roche, cat#11867423001 ...
-
bioRxiv - Microbiology 2020Quote: ... anti-HA (Roche, cat#11867423001 ...
-
bioRxiv - Cell Biology 2019Quote: ... anti HA (Roche), anti-V5 (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-HA (Roche) conjugated Dynabeads Protein A (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-HA (Roche), anti-GFP (ab6556 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti GFP (Roche) 1:1000 and anti-Mouse IgG (whole molecule)–Peroxidase antibody (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... anti-HA (Roche), anti-Pol II (Ab26721 ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-GFP (Roche, clones 7.1 and 13 ...
-
bioRxiv - Microbiology 2023Quote: ... anti-proteases (Roche)) ...
-
bioRxiv - Plant Biology 2024Quote: ... anti-GFP (Roche), anti-HA (high affinity clone 3F-10 ...
-
bioRxiv - Immunology 2021Quote: ... Culture media was supplemented with 500 U/mL human IL-2 (Tecin from Roche, kindly provided by the NIH) starting on culture day 2 ...
-
bioRxiv - Microbiology 2021Quote: ... and human acute promyelocytic leukemia cell line NB4 (ATCC) were washed once with the digestion buffer for neuraminidase (Roche), the cells were centrifuged at 2000 rpm for 5 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 ng of nick translated probe per coverslip was combined with 12 μg of human Cot-1 DNA (Roche), 10 μg salmon sperm ssDNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2023Quote: ... and NexCreERT2::R26R-tdT male mice received intraperitoneal injections (i.p.) of recombinant human (rh)EPO (5000 IU/kg body weight; NeoRecormon, Roche) or PL (solvent solution ...
-
bioRxiv - Neuroscience 2023Quote: Human induced pluripotent stem cell (iPSC) line KYOU-DXR0109B (ATCC) was routinely cultured on growth-factor reduced Matrigel (Roche) in mTeSR1 culture medium (StemCell Technologies ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Immunology 2024Quote: ... NK cells were cultured for the indicated amount of time with or without human IL-2 (TECINTM; teceleukin, ROCHE), human IL-15 (247-IL/CF ...
-
bioRxiv - Genomics 2022Quote: ... High Sensitivity DNA Analysis Kit and KAPA SYBR FAST qPCR Kit (Roche). WGS was performed on the HiSeq X (HCS HD 3.5.0.7 ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-HA (1:10,000; Pierce) or Anti-GFP (1:2000; Roche) served as primary Abs ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-EM48 (1:500; Chemicon) or anti-HA (1:500; Roche) antibodies and developed with biotinylated secondary anti-rabbit (1:500 ...
-
bioRxiv - Cell Biology 2022Quote: ... Anti-GFP (MBL, Japan, 598) and Anti-GFP (Roche, U.S.A., 11814460001) were used for CDRE-GFP ...
-
bioRxiv - Developmental Biology 2023Quote: ... incubating with either anti-digoxigenin or anti-fluorescein-POD antibodies (Roche) diluted at 1:300 ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNase free kit (Roche). RNA amount was quantified and cDNA was prepared using TaqMan Reverse Transcription Reagents (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... staining was performed by autostaining on a Discovery Ultra Ventana using the Discovery OmniMap anti-Rb HRP and Discovery ChromoMap DAB kits (Roche, Cat # 760-4311 and 760-159).
-
bioRxiv - Molecular Biology 2022Quote: In vitro transcribed RNA was prepared from linearized plasmid containing the human PTH 3’-UTR (68) using a Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... kidney (human primary renal proximal tubule epithelial cells, RPTEC) and liver (human hepatocellular carcinoma, HepG2) cells were assessed using a standard WST-1 (Roche) cell viability assay ...
-
bioRxiv - Microbiology 2020Quote: Damage to the human colon epithelial cell line HT-29 was assessed using a lactate dehydrogenase (LDH) cytotoxicity detection kitPLUS (Roche), which measures the release of the LDH enzyme in the growth medium ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were seeded subconfluently o/n (unless indicated otherwise) onto coverslips acid-washed and coated with human fibronectin (25 μg/ml, #11051407001, Roche), as described (Dimchev and Rottner ...
-
bioRxiv - Cancer Biology 2022Quote: ... All embryonic histology slides and human tissue microarray (BioMax, U.S. #BC001134b) slides were scanned using a Ventana DP200 slide scanning system (Roche Diagnostics) at 20x magnification ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and the candidates were PCR amplified from a U2OS (human bone osteosarcoma cell line) genome prep as template with the Kapa Hifi Hotstart Polymerase (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: A comprehensive list of coordinates of all the exonic and conserved regulatory elements from human X chromosome was used to design a customized capture library from Roche, NimbleGen (Supplementary Table 1) ...
-
bioRxiv - Cell Biology 2021Quote: Human pluripotent stem cells (hPSCs) were maintained in E8 medium and passaged every 4 days onto matrigel-coated plates (Roche). The following hPSC lines were used in the study ...
-
bioRxiv - Developmental Biology 2021Quote: H9 human pluripotent stem cells were maintained in E8 media and passaged every four days onto matrigel-coated plates (Roche). ESCs ...
-
bioRxiv - Cell Biology 2023Quote: ... CD4+ T-cells were plated in 200ul of medium (RPMI, 10% human serum) containing IL-2 (Roche, 10 IU/mL) and IL-7 (Peprotech ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... kidney (human primary renal proximal tubule epithelial cells, RPTEC), and liver (human hepatocellular carcinoma, HepG2) [45–50] cells were assessed using a standard WST-1 (Roche) cell viability assay ...
-
bioRxiv - Immunology 2023Quote: K2 cells or human neutrophils were lysed with 150-200 µl of lysis buffer (supp. Table 2) supplemented with 1X complete inhibitor (Roche) and incubated for 10 min at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: Frozen brain tissues from human and animals were used to prepare 10% (w/v) homogenates in RIPA buffer containing PI and PhosStop (Roche). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... followed by library preparation with KAPA RNA HyperPrep kit (Roche, kit code KK8541), according to manufacturer instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... and the immuno-complexes was then analysed on a 10% SDS-PAGE gel using immunoblotting methods with Abcam (Cambridge, UK) anti-GFP and anti-HA antibodies (Anti-HA High Affinity Roche 3F/10 ...
-
bioRxiv - Neuroscience 2021Quote: ... Bound probes were detected with anti-Digoxigenin and anti-Fluorescein antibodies (Roche) and staining was amplified using a TSA staining Kit (Perkin Elmer (NEL0701001KT) ...
-
bioRxiv - Immunology 2022Quote: ... cells were incubated with anti-TLR7 antibody and anti-HA antibody (Roche) at 37 °C for 90 min ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-HA (AB_390919, Roche), and anti-Flag (AB_259529 ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-HA Rat (Roche), anti-Histone H3 Rabbit (Abcam) ...
-
bioRxiv - Neuroscience 2021Quote: ... Anti-Digoxigenin-POD (Roche) antibody at 1:200 dilution in blocking buffer was applied onto the sections and incubated for 1 hour at RT ...
-
bioRxiv - Molecular Biology 2021Quote: ... rat anti-HA (Roche), 1:1000 ...