Labshake search
Citations for Roche :
301 - 350 of 1977 citations for Adenovirus Type 5 Particles CMV GFP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Anti-GFP primary mouse monoclonal antibody (1814460, Roche) was diluted 1:2500 and Santa Cruz (sc-2055 ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse monoclonal antibodies against GFP (Roche Diagnostics), Pgk1 (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2022Quote: ... Antibodies used: Mouse anti-GFP primary antibody (Roche) at 1:3,000 dilution ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-GFP (mouse, Roche AB_390913, Substrate 1:1); anti-actin (mouse ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-GFP (clones 7.1 and 13.1, Roche); rabbit anti-AP3M1 (ab201227 ...
-
bioRxiv - Neuroscience 2020Quote: ... Mouse anti-GFP (1/600; Cat#11814460001, Roche). The secondary antibodies used were ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-GFP (1: 1000, Cat No: 11814460001, Roche); anti-MYC (1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:1000 mouse monoclonal anti-GFP (Roche, 11814460001), 1:1000 mouse monoclonal anti-HA (3F10 ...
-
bioRxiv - Plant Biology 2020Quote: ... and rabbit anti-GFP (Roche, Cat. No. 11814460001). Densitometric band quantifications after immunodetections were done with the FUSIONCapt Advance program (PEQLAB).
-
bioRxiv - Molecular Biology 2020Quote: ... mouse anti-GFP (clones 7.1 and 13.1, Roche Applied Science ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-GFP (clones 7.1 and 13.1, Roche), rabbit anti-ADF1 (61) ...
-
bioRxiv - Plant Biology 2020Quote: ... The anti-GFP antibody was obtained from Roche Diagnostics (Indianapolis ...
-
bioRxiv - Cell Biology 2021Quote: ... were incubated with anti-GFP antibody (Roche Diagnostics) for 20 min at room temperature and after washing with phosphate-buffered saline (PBS ...
-
bioRxiv - Molecular Biology 2020Quote: Mouse anti-GFP (11 814 460 001, Roche), rabbit anti-GTSE1 (custom generated ...
-
bioRxiv - Developmental Biology 2022Quote: ... Membranes were developed with anti-GFP (Roche 11814460001).
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-GFP (Roche, clone 7.1 and 13.1) and rabbit anti-Atp2 (32 ...
-
bioRxiv - Molecular Biology 2023Quote: ... monoclonal mouse anti-GFP antibody (Roche; Basel, CH) and monoclonal rat anti-HA antibody (Roche ...
-
bioRxiv - Bioengineering 2022Quote: ... Antibodies used: anti-GFP monoclonal (Roche Applied Science), anti-TDP-43 polyclonal (Proteintech) ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-GFP (1181446000, Roche, WB 1:1000), mouse anti-WIPI2 (MCA5780GA ...
-
bioRxiv - Molecular Biology 2023Quote: ... GFP (Roche, 11 814 460 001, 1:500). Secondary antibodies used were anti-mouse IgG-HRP (Dako ...
-
bioRxiv - Microbiology 2023Quote: ... anti-GFP (mouse, 1:1k, Sigma, 11814460001 (Roche)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... GFP (Roche 11 814 460 001, 1:500), TRF1 (Rabbit ...
-
bioRxiv - Plant Biology 2023Quote: ... α-GFP(mouse)-1:1500 (Roche Diagnostics, Basel, Switzerland), α-RFP(rat)-1:1,000 (ChromoTek ...
-
bioRxiv - Plant Biology 2023Quote: ... Primary antibody (1:1000, anti-GFP (Roche, #11814460001) or anti-HA-HRP (Thermo Fisher ...
-
bioRxiv - Microbiology 2023Quote: ... Mouse α-GFP antibodies (dilution: 1:2,000) (Roche) were used together with horseradish peroxidase-conjugated sheep α-mouse immunoglobulin G (dilution ...
-
bioRxiv - Microbiology 2023Quote: ... and mouse anti-GFP antibody (Roche, Basel, Switzerland). Mouse antisera against MD3 and RNF1 were generated as described below ...
-
bioRxiv - Genetics 2024Quote: ... 1:1000 anti-mouse GFP antibody (#11814460001, Roche), 1:1000 anti-mouse α-tubulin antibody (#T9026 ...
-
bioRxiv - Cell Biology 2023Quote: ... A primary anti-GFP (#11814460001 Roche, 1:1000) was used to detect the different GFP constructs ...
-
bioRxiv - Microbiology 2024Quote: ... Mouse α-GFP antibodies (dilution: 1:2,000) (Roche) were used together with horseradish peroxidase-conjugated sheep α-mouse immunoglobulin G (dilution ...
-
bioRxiv - Microbiology 2024Quote: ... Primary antibodies were: monoclonal mouse anti-GFP (Roche) (1:1000) ...
-
β-catenin signaling via astrocyte-encoded TCF7L2 regulates neuronal excitability and social behaviorbioRxiv - Neuroscience 2020Quote: ... The numbers of DNA-containing viral particles was measured using the SYBR Green I Master Kit (Roche) and a LightCycler 480 Instrument II (Roche ...
-
bioRxiv - Neuroscience 2021Quote: ... Viral particles were quantified by real-time PCR Q-PCR using LightCycler480 SYBR Green I Master (Roche) and primers targeting the flanking sequence of ITR2 (GTAGATAAGTAGCATGGC and CTCCATCACTAGGGGTTCCTTG ...
-
bioRxiv - Zoology 2023Quote: Automated nucleic acid extraction from samples was performed using Magnetic Particle Processors (MagMax, KingFisher, Roche and others) and appropriate kits ...
-
bioRxiv - Cell Biology 2021Quote: The plasmids FUG-T2A-GFP-Cre and control GFP were purchased from Addgene #66691 and lentiviral particles were produced in HEK-293T cells using X-tremeGene 9 DNA Transfection Reagent (Roche). Upon ultracentrifugation concentrated virus particles were stored at −80°C and used to infect pancreatic ductal organoid cultures as previously described (Huch et al. ...
-
bioRxiv - Synthetic Biology 2023Quote: ... We incubated 5μl of clarified crude lysates containing rAAV particles with 50 units (U) of DNAse I (Roche) for 15hr at 37°C ...
-
bioRxiv - Microbiology 2020Quote: α-GDV1-GFP-DD and α-Pfs16 IFAs were performed with methanol-fixed cells using mouse mAbs α-GFP (1:200) (Roche, #11814460001) and α-Pfs16 (1:500 ...
-
bioRxiv - Biophysics 2021Quote: ... The oocytes were digested with type I collagenase (1.5 mg/mL, Roche) in OR-2 ...
-
bioRxiv - Genomics 2020Quote: ... 400 ng/ml DNase I Type IV (Roche PVT GmbH Waiblingen, Germany) in L15 medium (Gibco)] and carefully cut into small pieces ...
-
bioRxiv - Genomics 2020Quote: ... 40 μg/ml DNase I Type IV (Roche PVT GmbH Waiblingen, Germany)) samples were incubated for 15-20 min at 37°C ...
-
bioRxiv - Systems Biology 2022Quote: ... Both types of lysis buffer were supplemented with phosSTOP (Roche, catalog # 4906837001) and cOmplete (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: The experiments in all cell types were performed with Fugene HD (Roche) transfection reagent ...
-
bioRxiv - Plant Biology 2020Quote: ... A monoclonal anti-GFP antibody (Roche, cat. no. 11814460001) was used at 1:3000 dilution and combined with a 1:20000 rabbit anti-mouse secondary antibody (Agrisera ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-GFP (Roche, 11814460 001, 1:2000), monoclonal mouse anti V5 (Invitrogen R960-25 ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-GFP antibody 13.1 + 7.1 (Roche, Merck, Darmstadt, Germany) or anti-CSP repeat antibody – mAB 3D11 (Yoshida et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... and anti-GFP (1:1000, 0.4 µg/ml; Roche).
-
bioRxiv - Neuroscience 2021Quote: ... and mouse anti-GFP antibody (1:500, Roche, RRID:AB_390913) diluted in TNB was added to each slide under a bridged coverslip and incubated at 4°C overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... then blotted with mouse anti-GFP antibody (Roche 11814460001) and anti-mouse-HRP secondary (Cell Signaling 7076) ...
-
bioRxiv - Neuroscience 2021Quote: ... a concentration of 1:500 anti-GFP (Roche 11814460001) and 1:5000 anti-mouse HRP (Millipore AP308P ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1 uL of anti-GFP antibody (Roche 11814460001) were used to pull down DMA-1::GFP and KPC-1::GFP overnight at 4C ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse anti-GFP (7.1+13.1, Roche, 11814460001; 1:1000), rabbit anti-Caveolin (BD Biosciences 610059 ...