Labshake search
Citations for Roche :
1 - 50 of 8314 citations for Acetamide N 2 3 dihydro 2 3 hydroxy 2 quinolinyl 1 3 dioxo 1H inden 5 yl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay (Roche) was performed following manufacturer’s indications ...
-
bioRxiv - Cancer Biology 2024Quote: ... Then 3-(4,5-dimethyl thiazol- 2-yl)-2,5-diphenyl tetrazolium bromide (MTT) labeling reagent (Roche) was added followed by solubilization buffer 2h later ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Roche, #11465007001) and CellTiter-Glo Luminescent Cell Viability (CTG ...
-
bioRxiv - Molecular Biology 2020Quote: Cell viability was tested by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Roche, Mannheim, Germany), according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay (11465007001, Roche Diagnostics, Mannheim, Germany) was performed according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: The cytotoxicity assays were performed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Roche, ref:11465007001) protocols according to the previous study [47] with few modifications ...
-
bioRxiv - Biochemistry 2024Quote: Cell metabolic viability was measured by the colorimetric MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay kit (Roche). After treatments ...
-
bioRxiv - Genomics 2024Quote: ... included 1.11 μM N7XX (5′-CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTCTCGTGGGCTCGG-3′) and S5XX (5′-AATGATACGGCGACCACCGAGATCTACACXXXXXXXXTCGTCGGCAGCGTC-3′) primers (384PP_AQBP) in 2× HiFi HotStart ReadyMix (Roche, KK2602, 6RES_GPSA). Dual barcode sequences in primers are denoted by “XXXXXXXX.” Unique dual barcode combinations for each well of a 384-well plate were achieved by dispensing 16 unique N7XX barcodes across each row and 24 unique S5XX barcodes across each column ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µg/ml of glycerol 3-phosphate dehydrogenase (Roche) and 5 µg of cell free protein extract ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell viability was assessed by addition of 5 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (i.e., MTT) using a Cell Proliferation Kit I (Roche Diagnostics, Mannheim, Germany), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: Metabolic activity was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)-assay (Cell Proliferation Kit I, Roche Germany, Mannheim) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
bioRxiv - Biophysics 2021Quote: ... 0.1% (v/v) 2-mercaptoethanol and 60 × 10−3 М n-Octyl-β-D-Glucopyranoside) containing protease inhibitor (Roche). Total protein was collected and incubated with anti-p75NTR (Alomone ...
-
bioRxiv - Biophysics 2021Quote: ... 10% w/v glycerol, 20 mM imidazole, 5 mM 2-mercaptoethanol, 1 mM PMSF, 3 U/mL benzonase, 1X Roche complete protease inhibitor without EDTA) ...
-
bioRxiv - Cancer Biology 2024Quote: ... concentrations was assessed using reduction in WST-1 (4-[3-(4-Iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]- 1,3-benzene Disulfonate) to water-soluble formazan (Roche, France). Cells were seeded in 96-well plates at 2 × 104 cells/well and treated with the different NAM concentrations at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... and whole transcription amplification (WTA) with KAPA HotStart HIFI 2 3 ReadyMix (Kapa Biosystems) for 18 cycles ...
-
bioRxiv - Cell Biology 2020Quote: Cell viability was determined by MTT (C, N-diphenyl-N′-4,5-dimethyl thiazol-2-yl tetrazolium bromide) assay (Roche, Switzerland), a standard colorimetric assay which uses the metabolic reduction of the tetrazolium salt to form the colored formazan product [33] ...
-
bioRxiv - Developmental Biology 2021Quote: ... for five minutes at room temperature before being incubated in the dark with 2% Nitro-Blue Tetrazolium Chloride/5-Bromo-4-Chloro-3⍰-lndolyphosphate p-Toluidine Salt (NBT/BCIP; Roche) in buffer 3 at room temperature until staining developed ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’/3’RACE Kit (Roche) was used to amplify the RNA obtained and the final DNA was sequenced to obtain the +1 nucleotide of str ...
-
bioRxiv - Biochemistry 2020Quote: ... samples were then digested for a further 3 hrs with 2 μg Chymotrypsin (Roche 11418467001) at 25°C ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were resuspended in 1000 µL cold cytoplasmic lysis buffer (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Microbiology 2023Quote: ... cells were resuspended in 1000 µL cold sucrose buffer containing (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Plant Biology 2021Quote: ... in paraffin-embedded sections (8µm) and color was detected with 5-bromo-4-chloroindol-3-yl phosphate/nitrateblue tetrazolium (BCIP/NBT) (Roche).
-
bioRxiv - Bioengineering 2022Quote: ... and then inflated via the trachea with 2-3 mL of pre-warmed (37°C) enzyme solution (1 mg/mL collagenase/dispase [Roche] ...
-
bioRxiv - Immunology 2022Quote: ... the slides were washed in TBS/T 3 times and then incubated with secondary antibodies (2 µg/ml) and DAPI (1 µg/ml, Roche) for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... and 2 µg) of HIV-1 NL4-3 full-length replication competent plasmid using X-tremeGENE HP (Roche Applied Science) transfection reagent as per manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... rp49 5’-TAATACGACTCACTATAGGGCAGTAAACGCGGTTCTGCATG-3’ and 5’-CAGCATACAGGCCCAAGATC-3’) were transcribed using the Biotin RNA Labeling Mix (Roche) and T7 polymerase (Promega).
-
bioRxiv - Cancer Biology 2020Quote: ... An overnight blunt ligation was induced for the 5’ of exon 1 and the 3’ of exon 3 (5 U T4 DNA ligase (Roche, Basel, Switzerland)) at room temperature ...
-
bioRxiv - Immunology 2021Quote: Total protein lysates from MDDC and cDC cultured for 1 h in the presence of media or individual or combined Poly I:C and 2′3′-di AM(PS) agonists were obtained using RIPA buffer containing 1% phosphatase and protease inhibitors (Roche Diagnostics). Subsequently ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and amplified 6 times (Sets 1 and 2) or 8 times (Set 3) with a KAPA Library Amplification Kit (KAPA Biosystems). The amplification products were cleaned using Agencourt Ampure XP reagent or KAPA Pure Beads ...
-
bioRxiv - Biophysics 2021Quote: ... 3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate (CHAPS, Roche Life Sciences, Indianapolis, IN) micelles and also using 1,2-dihexanoyl-sn-glycero-3-phosphocholine (DHPC)/1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... and 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) (pH 8.0) and the presence of Complete® protease inhibitor (Roche). The preparation was centrifuged for 10 min at 2500 rpm and 4 °C and supernatant was transferred to a new tube and centrifuged for 40 min at 30,000 x g and 4 °C ...
-
bioRxiv - Genetics 2021Quote: ... and cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C followed by a centrifugation step ...
-
bioRxiv - Genetics 2021Quote: ... 30 million equivalent cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C and collected cells by a centrifugation step ...
-
Single cell transcriptomics reveals the effect of PD-L1/TGF-β blockade on the tumor microenvironmentbioRxiv - Genomics 2020Quote: ... (2 mg/kg; atezolizumab, Roche; n = 12). Group 3 received anti-TGF-β I.P ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- AAACTCAAAKGAATTGACGG-3’ /1062R: 5’-CTCACRRCACGAGCTGAC-3’, (Bacchetti De Gregoris et al., 2011) on a LightCycler 480 Instrument II (Roche). The global predicted coverage of this primer pair is 94.1% of all bacterial sequences present in Silva SSU r138.1 (Silva Testprime with only one mismatch allowed ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were resuspended in buffer1 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Protease inhibitors (Roche)) and incubated for 20 min at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cell pellets resuspended in LB1 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2 supplemented with protease inhibitors [Roche]) for 5 minutes at 4 °C followed by centrifugation (1,000g ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were resuspended in buffer2 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Protease inhibitors (Roche), 0.5 % IGEPAL CA-630 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Data from 2-3 technical replicates for all three biological replicates were analyzed in LightCycler® 96 software (Roche), Google Sheets ...
-
bioRxiv - Developmental Biology 2024Quote: ... 100 μl of MNase buffer (0.3 M Sucrose, 85 mM Tris, 3 mM MgCl2, 2 mM CaCl2, 2.5U of micrococcal nuclease: Roche 10107921001) was added in to each tube (0.5 millions of cells per tube) ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... For isolation of nuclei the cell pellet was resuspended in Buffer 1 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 20 min followed by a centrifugation step ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...