Labshake search
Citations for Roche :
201 - 250 of 2101 citations for AKT1 2 3 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... 3 µL 10% Tween-20 (Roche 11332465001), freshly add 3 µL 1:1 water diluted digitonin (Promega G9441) ...
-
bioRxiv - Plant Biology 2019Quote: ... 3 uL of DNaseI (10U/ul Roche), 8 uL buffer (200 mM Tris ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 10 mM CaCl2 for 45 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 5 mM CaCl2 for 45 min at 37 °C with shaking ...
-
bioRxiv - Neuroscience 2023Quote: ... retigabine (3 mg/kg, Roche Pharmaceuticals, CH), nicotine (5 mg/kg ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 mg/mL Dispase II (Roche, 04942078001), and 0.1 mg/mL DNase I (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... The membrane was then incubated in antibody detection solution consisting of 1:20000 anti-HA rat mAb conjugated to horseradish peroxidase (HRP) (Roche [3F10], Cat. # 1201381900) diluted in MTBST 0.05% for 1 hour at room temperature on a tube rotator ...
-
bioRxiv - Microbiology 2021Quote: ... and 100 U/mL human interleukin 2 (IL-2) (Roche) (Munoz et al. ...
-
bioRxiv - Microbiology 2021Quote: ... 2 M CaCl2 and 2 UU/ml DNAse I (Roche) for 30 min at 37°C ...
-
bioRxiv - Biophysics 2019Quote: ... and 30 IU/mL human interleukin-2 (hIL-2) (Roche).
-
bioRxiv - Biophysics 2021Quote: ... 2 mM MgCl2) supplemented with 2 protease inhibitor tablets (Roche), 1 mM PMSF ...
-
bioRxiv - Immunology 2023Quote: ... and 30 IU/mL human interleukin-2 (hIL-2) (Roche). To ectopically express Lifeact-eGFP or Lamp1-eGFP in CTLs ...
-
bioRxiv - Cancer Biology 2020Quote: ... grade 2 (Roche), homogenizing for 20min with a plastic Pasteur pipette ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-CAGACACGCAGACTCTTTC-3’) and 2.5 µl reverse primer (10 µM; 5’-CTAAAGATGTGTGTCTTCCTCA-3’) using the Expand Long Template PCR System (Roche). The PCR conditions were 35 cycles at 95°C for 30 sec ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... for 30 min at 4°C on a rotator and S1 (1 ml for cerebellum and 1 ml for cerebrum) was incubated with 5 μg of anti-HA mAb (Roche, clone 12CA5, RRID: AB_514505) at 4°C for 60 min on a rotator ...
-
bioRxiv - Cell Biology 2021Quote: ... 2% SDS and 2 mg/ml protease inhibitor 18 (Complete, ROCHE MOLECULAR DIAGNOSTICS ...
-
bioRxiv - Cancer Biology 2022Quote: ... and human epidermal growth factor 2 (HER-2) (790–4493, Roche).
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Neuroscience 2022Quote: ... were transfected into HEK293 cells at a ratio of 3:3:1 (hGluN1/hGluN2A/EGFP) using X-tremegene HP (Roche) at a 1:100 ratio with optiMEM ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 tablets of EDTA-free cOmplete inhibitor (Roche) were added to the media which was then centrifuged at 14,000 × g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 mg/ml Dispase II (Roche, Indianapolis, IN), and 1 mg/ml trypsin inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 tablets complete protease inhibitor EDTA free (Roche) and 1 tablet PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3) Complete protease inhibitor cocktail (Roche, cat #11836153001) was included for final 1X concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Genetics 2023Quote: ... and dithiothreitol (Roche; cat. no. 3483-12-3). Lysates were rocked at 4° C for 20 min and centrifuged for 10 min at 15,000 × g ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP phosphatase inhibitor Cocktail (Roche) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 mg/ml dispase II (Roche Diagnostics) in CMF Hank’s solution ...
-
bioRxiv - Microbiology 2024Quote: ... with buffer 3 or the Taq polymerase (Roche). The initial denaturation for Taq polymerase at 95 °C for 5 min was followed by 30 amplification cycles of 1 min at 95 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 U/ml dispase II (Roche Diagnostics, 4942078001), and 10 mM CaCl2 for 30 min at 37 °C with occasional shaking ...
-
bioRxiv - Molecular Biology 2019Quote: LDH from rabbit muscle (Roche) was diluted to 5 µg/mL in 5-fold diluted boiled supernatants (for Figure 1E) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... HA-epitope tagged recombinant proteins were detected using a rat-derived monoclonal anti-HA antibody (dilution 1:200, Roche) followed by a secondary anti-rat antibody coupled to AlexaFluor 594 fluorophores (dilution 1:200 ...
-
bioRxiv - Cell Biology 2019Quote: ... 500mM NaCl, 1mM TCEP-HCl (ThermoScientific, 20491) pH 7.4 which was supplemented with recombinant DNase I (1000U) (Roche,04536282001), cOmplete protease EDTA-free inhibitor cocktail (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... HA-epitope tagged recombinant proteins were detected using a rat-derived monoclonal anti-HA antibody (dilution 1:200, Roche) followed by a secondary anti-rat antibody coupled to AlexaFluor 488 fluorophores (dilution 1:200 ...
-
bioRxiv - Microbiology 2022Quote: ... cells were resuspended in a 50 mM sodium phosphate buffer at pH 7.8 (buffer A) supplemented with DNase I (100 U, DNase I recombinant, RNase-free Roche), and disrupted using a French Pressure Cell (3 cycles at 1100 psi) ...
-
bioRxiv - Immunology 2019Quote: Purified B cells were cultured either in medium alone or in the presence of 1.56-25ng ml− of recombinant BAFF for the indicated time and stained with Annexin V (Roche) and 7-aminoactinomycin D (7-AAD ...
-
bioRxiv - Neuroscience 2021Quote: The tissue was dissociated in 300 µL of 0.25% trypsin-EDTA solution supplemented with 10 U/mL recombinant DNase I (Roche) for 15 minutes at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... and NexCreERT2::R26R-tdT male mice received intraperitoneal injections (i.p.) of recombinant human (rh)EPO (5000 IU/kg body weight; NeoRecormon, Roche) or PL (solvent solution ...
-
bioRxiv - Genetics 2019Quote: ... and RIPA double-detergent buffer (2% deoxycholate, 2% NP40, 2% Triton X-100 in RIPA homogenizing buffer) supplemented with a protease-inhibitor cocktail (Roche). Cells were subsequently incubated on ice for 30 minutes ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 mM MgCl2, 2 mM DTT, 2 µM leupeptin, 2 mM PMSF, 250 mM sucrose, and 1× PhosSTOP phosphatase inhibitors [Roche]). The homogenate was centrifuged for 15 min at 10,000 × g at 4°C ...
-
bioRxiv - Genetics 2023Quote: ... and RIPA double-detergent buffer (2% deoxycholate, 2% NP-40, 2% Triton X-100 in RIPA homogenizing buffer) supplemented with protease inhibitor cocktail (Roche), as described previously (Kemaladewi et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the gRNA_enrichment1_fw (5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTGTG-GAAAGGACGAAACACCG-3’) and gRNA_enrichment1_rv (5’-CTACACGAC-GCTCTTCCGATCT-3’) primers and the 2x KAPA HiFi HotStart Ready Mix (Roche, Cat. No. KK2601). In a subsequent PCR ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...