Labshake search
Citations for Roche :
1 - 50 of 1501 citations for ADAM Metallopeptidase Domain 7 ADAM7 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 7 μg/ml insulin (Roche, #11376497001), and 15 mg/ml transferrin (Roche ...
-
bioRxiv - Biochemistry 2021Quote: The RBD domain variants (see Table S1) were PCR amplified (KAPA HiFi HotStart ReadyMix, Roche, Switzerland) from codon-optimized SARS-CoV-2 Spike protein gene (Sino Biological ...
-
bioRxiv - Cell Biology 2019Quote: ... 7 μg/ml transferrin (Cat.# 652202, Roche) and 150 units penicillin/streptomycin (Cat.#15140) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 7 μl proteinase inhibitor 7X (Roche, 04693159001) and 5 μl phosphatase inhibitor 10X (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... and 0.025% pronase (Roche, 7 U/mg)] in complete DMEM/F-12 medium in a spinner flask ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TP53 (DO-7) (platform Ventana, Roche).
-
bioRxiv - Biochemistry 2020Quote: ... COS-7 cells were transfected using FuGENE6 (Roche) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... CD8 (clone SP57 at 1:7, Ventana- Roche), PD-1 (clone NAT105 ...
-
bioRxiv - Microbiology 2023Quote: ... 7 μM KAPA Unique Dual-Indexed (UDI, Roche) adapters were ligated to the second strand synthesis product in the presence of a ligation master mix in a reaction that was performed at 20 °C for 15 min ...
-
bioRxiv - Biophysics 2023Quote: ... and 7 U/mL DNase I (04536282001, Roche). Cells were lysed and the lysate clarified as above ...
-
bioRxiv - Biophysics 2023Quote: ... and 7 U/mL DNase I (04536282001, Roche). The resuspended cells were rotated end-over-end for 30 min at 4 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... 7 µM KAPA-single index adapters (Roche, KK8700d) were added to A-tailed cDNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... 200 μM dNTPs (with 3:1 mix of 7-deaza-dGTP:dGTP; dNTPs from New England Bio Labs, cat#N0446, 7-deaza-2’-deoxy-GTP from Roche, cat#10988537001), 0.8 M Betaine (Alfa Aesar ...
-
bioRxiv - Microbiology 2022Quote: ... We excluded those with evidence of previous COVID-19 (defined as a positive NAAT COVID-19 test or presence of anti-nucleocapsid antibodies in the blood [Roche, IND, USA] 7) given the known differential impact on antibody responses post-vaccination.8 We also excluded cases for whom the second vaccine was >130 days after the first ...
-
bioRxiv - Biochemistry 2021Quote: ... 7 mM β-mercaptoethanol and protease inhibitor cocktail (Roche complete ...
-
bioRxiv - Molecular Biology 2022Quote: ... a mix of 7 μl of proteinase K (Roche), 1 μl of glycogen (Sigma G1767-1VL ...
-
bioRxiv - Immunology 2021Quote: ... hydrocortisone hemisuccinate (7×10−5 M, Roche-Boehringer-Manheim) and FCS (10% selected ...
-
bioRxiv - Cell Biology 2020Quote: ... or His6 (full length mouse MLKL and pseudokinase domains) tags and captured from lysates using glutathione resin (UBP Bio) or HisTag Ni-NTA resin (Roche) respectively ...
-
bioRxiv - Microbiology 2019Quote: ... and the ketoreductase-B domain of the mycolactone polyketide synthase genes (KR-B) [22] using RT-PCR reagents from Roche PCR Kit (Roche Diagnostics ...
-
bioRxiv - Biophysics 2022Quote: ... The recombinant human Sox6 HMG domain was purified from supernatant of bacterial lysate by using NiNTA resin (Complete His-Tag purification Resin, Roche) and followed by SP sepharose column chromatography (GE Healthcare) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6 mM creatine phosphate (Roche, Cat. No. 71519-72-7), 102 ng/μl creatine kinase (Roche ...
-
bioRxiv - Biochemistry 2019Quote: ... The transfection of GFP-RNase H1 R-loop-binding domain (GFP-HB) for R-loop detection into HEK293 cells was performed with the FuGENE Transfection reagent (Roche, E269A).
-
bioRxiv - Cancer Biology 2019Quote: ... supplemented with 7-Deaza-dGTP using the LightCycler 480 software (Roche).
-
bioRxiv - Biophysics 2021Quote: ... 7% 2H2O and supplemented with EDTA-free protease inhibitor cocktail (Roche). Final protein concentrations were 0.3-0.6 mM ...
-
bioRxiv - Biophysics 2023Quote: ... pH 7) with addition of cOmplete tablets EDTA-free (04693132001, Roche, Switzerland), 0.5 mM Na3VO4 ...
-
bioRxiv - Immunology 2023Quote: 7-plex IF panel was created using the Ventana BenchMark Ultra (Roche Diagnostics) automated staining platform ...
-
bioRxiv - Cancer Biology 2023Quote: ... The samples were immunostained for Ki67 (clone 30-9 at 1:7, Ventana- Roche), CD8 (clone SP57 at 1:7 ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 mM Tris-HCl (pH 7) and EDTA-free protease inhibitor cocktail (cOmplete™, Roche # 11873580001). After 30 min incubation on ice ...
-
bioRxiv - Genomics 2020Quote: ... 0.1% IGEPAL CA-630)7 supplemented with protease inhibitors (Complete Protease Inhibitor Cocktail, EDTA-free, Roche). Embryos were homogenized in a Dounce homogenizer then incubated in cold lysis buffer at 4°C for 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... and fractions 7–10 (cytosolic ribosomes) were pooled and treated with PCR grade proteinase K (Roche) in 1% SDS to release ribosome protected fragments ...
-
bioRxiv - Cancer Biology 2022Quote: ... in deionized phosphate-buffered saline (PBS)] supplemented with 1:7 proteases inhibitors cocktail (Roche Diagnostics GmBH, Germany) for 10 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... The libraries were indexed using KAPA Unique Dual-Indexed Adapter Kit at 7 µM (KK8727, Roche Life Science) and 7 cycles of PCR library amplification were used ...
-
bioRxiv - Microbiology 2019Quote: ... cells were harvested at 0 to 7 DPI in RIPA buffer containing protease and phosphatase inhibitor cocktails (Roche). Protein concentrations were determined by bicinchoninic acid (BCA ...
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA extracted from the parasites at passages 7 and 20 were digested with 5 U Rsa1 (Roche) at 37 °C overnight ...
-
bioRxiv - Physiology 2024Quote: ... from two bees were pooled and homogenized in 250 µL of phosphate-buffered saline (7 mM NaCl, 2.7 mM KCl, and 10 mM PO4, pH 7.4) containing cOmplete protease inhibitors (Roche) at kept on ice until further processing ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mL of the culture was then treated with either 5 µl of MeOH or LMB dissolved in 7:3 MeOH:H2O solution (Roche) at a final concentration of 50 ng/mL for 45 min before imaging.
-
bioRxiv - Genomics 2020Quote: ... Day 4 (HH21-24) and day 7 (HH30-31) ventricular samples were digested in 1.5mg/mL collagenase type II/ dispase (Roche) for one cycle of 20 minutes and one cycle of 10 minutes under mild agitation at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... The library amplification step included 6-7 PCR cycles and was performed using the KAPA Library Amplification kit (Roche). The final Hi-C library was purified using SPRIselect beads and the quality and size of the library (approximately 500 bp ...
-
bioRxiv - Genomics 2020Quote: ... Library fragments were then subjected to 7 cycles of PCR amplification with KAPA HiFi Uracil+ DNA polymerase (KAPA Biosystems). Single-end 100 bp sequencing was performed on a HiSeq 1500 or a MiSeq (Illumina).
-
bioRxiv - Neuroscience 2021Quote: ... Samples were homogenized by sonication in PBS (pH=7) mixed with a protease inhibitor cocktail (Complete®, Roche, Spain). After adjusting protein levels ...
-
bioRxiv - Immunology 2022Quote: ... was added and cells were centrifuged at 350g for 7 min at 4°C and resuspended in PBS with 0.5% BSA (Roche) and 1% FBS (Sorting Buffer) ...
-
bioRxiv - Biophysics 2022Quote: ... Antibodies used: Mouse anti-GFP primary antibody (Roche) at 1:3,000 dilution ...
-
bioRxiv - Cancer Biology 2021Quote: ... MCF-7 shRNA and MCF-7 shFTH1 as well as H460 shRNA and H460 shFTH1 using the High Pure RNA isolation kit (Roche) according to the manufacturer’ ss instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... qPCR analysis was performed using primers detailed in Supplementary file 7 on a Roche Lightcycler 480 II (Roche Holding AG) using LightCycler 480 SYBR Green I Master mix (Roche Holding AG ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The resulting 1,055 samples of differentiated EBs were lysed after 7 days in 350 μl MagNA Pure LC RNA Buffer (Roche Diagnostics) and purified using an automated MagNA Pure 96 system (Roche Diagnostics) ...
-
bioRxiv - Genomics 2019Quote: ... An additional Proteinase K incubation (65 μl of 10mg/mL per 7 million cells starting material) at 65°C for two hours was followed by RNase A (Roche; 15 μl of 10mg/mL per 7 million cells starting material ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.7 µM of total delta-Phe aa-tRNA (total tRNA charged with all amino-acids except Phe; tRNA from Roche) and 100 nM of EF-G were used ...
-
bioRxiv - Cell Biology 2020Quote: ... Transfected HEK29T cells and COS-7 cells were washed and lysed with 1% Triton X-100 in PBS with protease inhibitor cocktail (Roche) at 4 °C for 1 hr ...
-
bioRxiv - Microbiology 2021Quote: ... The cell lysate was prepared by sonication of 2×108 cells on ice in 100 mM sodium phosphate buffer pH 7 including EDTA-free Complete Protease Inhibitors (Roche) and 0.01% TX-100 ...