Labshake search
Citations for Roche :
501 - 550 of 1645 citations for ACE 2 Human HEK293 His Avi since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... and then with DAPI (4′,6-Diamidino-2-phenylindole, Roche) for 15 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... 0.1% SDS) containing 2 μg/mL protease inhibitors (Roche, Germany). The supernatants of cell lysates were collected before their protein concentrations were determined using a BCA protein assay kit (Pierce Biotechnology ...
-
bioRxiv - Developmental Biology 2019Quote: ... 2?mM EDTA) supplemented with protease inhibitor cocktail (Roche Diagnostics) and cleared by centrifugation at 12,000x?g at 4?°C for 10?min ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% Triton X-100) with 2% complete protease inhibitor (Roche) for 20min on ice ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 2% NP-40) with the addition of protease inhibitor (Roche cOmplete mini-pellet ...
-
bioRxiv - Physiology 2020Quote: ... Skin was incubated in 2 mg/ml Collagenase P (Roche) in Krebs solution (in mM ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM DTT and EDTA-free protease inhibitor tablets (Roche). Sonicate supernatants were loaded onto GST-4B resin (Amersham ...
-
bioRxiv - Genetics 2021Quote: ... 2 mM EDTA) supplemented with a protease inhibitor cocktail (Roche) and 1 mM DTT ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2 mM EDTA) supplemented with protease inhibitor cocktails (Roche), and sonicated for 10 s ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μg/ml RNase A and protease inhibitor mixture (Roche). Proteins were bound to Ni-NTA resin (GE Healthcare ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM β-mercaptoethanol in presence of Dnase 1 (Roche), EDTA-free protease inhibitor coctail (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM Pefabloc and protease inhibitor (Mini Complete, Roche, Switzerland).
-
bioRxiv - Genetics 2019Quote: ... and 2 μL of RNAse A (Roche 1 119 915) were added and left for one hour at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM PMSF and protease inhibitors (Roche Diagnostics, Mannheim, Germany)) by disruption with glass beads ...
-
bioRxiv - Developmental Biology 2022Quote: ... Total RNA (2 μg) was mixed with oligo-dT (Roche) and dNTP (Yeastern ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2 mM MgCl2 and EDTA-free protease inhibitor cocktail (Roche)) and lysed in an ice-cold sonicating water bath for 5 minutes ...
-
bioRxiv - Developmental Biology 2022Quote: ... the sections were pre-blocked with 2% blocking reagent (Roche)/20% FBS/TBST at 25ºC for 1 h ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were blocked in 2% DIG blocking reagent (Roche, 11096176001) in MABT for two hours at RT ...
-
bioRxiv - Neuroscience 2022Quote: ... SDS 0.1% with protease (2%) and phosphatase (10%) inhibitors (Roche)) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 mM PMSF) supplemented with cOmplete Protease Inhibitor Cocktail (Roche) and PhosSTOP (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... Blocking was performed in 1xMABT with 2% Blocking Reagents (Roche) and 10% donkey serum (Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: ... they were blocked with 2% bovine serum albumin (BSA, Roche). Samples were incubated overnight at 4°C in the same blocking buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM EDTA) supplemented with protease and phosphatase inhibitors (Roche) and lysates were sonicated followed by quantification using the Pierce BCA protein assay (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 tablets of cOmplete EDTA-free protease inhibitor cocktail (Roche), 0.1 mg/ml lysozyme ...
-
bioRxiv - Genomics 2023Quote: ... 2 mM MgSO4 and protease inhibitor cocktail (Roche cat# 04693132001)) was added and bacteria was incubated on ice for 15 min before centrifugation for 20 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM 2-mercaptoethanol (BME) and protease inhibitor cocktail (Roche) using a combination of dounce homogenization and sonication ...
-
bioRxiv - Microbiology 2023Quote: ... 1% P/S and 50 U/mL IL-2 (Roche), at 37°C and 5% CO2.
-
bioRxiv - Cell Biology 2023Quote: ... and then to MABT with 2% blocking reagent (Roche, 11096176001) at 4°C overnight ...
-
bioRxiv - Bioengineering 2023Quote: ... Collagenase B solution 2 mg ml−1 B (Roche, Indiana) was used for HUVEC isolation (detailed protocol in 10) ...
-
bioRxiv - Physiology 2024Quote: ... 2 × KAPA SYBR FAST qPCR Master Mix Universal (KAPA Biosystems), 5 μl of sample solution ...
-
bioRxiv - Plant Biology 2024Quote: NATA1Δ and NATA2Δ were preincubated with 2 mM acCoA (Roche) and 5 mM of ligands (purchased from Sigma ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 mM benzamidine) + protease inhibitors (1 tablet / 50 ml Roche Complete Ultra EDTA-free ...
-
bioRxiv - Molecular Biology 2024Quote: ... or Light Cycler 96 system (Roche, Basel, Switzerland; Exp. 2). The species-specific primer-probe set for each target region of Ayu was shown in Table 1 (see Result) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and were then stained with the mouse monoclonal antibody against the human P16 protein (Ventana Roche-E6H4, USA) and the FITC-tagged secondary antibody ...
-
bioRxiv - Cell Biology 2021Quote: Human stem cells and neurons lysed with RIPA lysis buffer supplemented with 5mM EDTA and protease inhibitor (Roche), for 5 minutes at room temperature and 10 minutes on ice ...
-
bioRxiv - Immunology 2021Quote: ... freshly resected human samples were cut into small fragments and digested with 0.1 mg/ml Liberase TL (Roche) and 0.1 mg/ml DNase (Roche ...
-
bioRxiv - Developmental Biology 2021Quote: On day 0 (start of differentiation) human pluripotent stem cells were treated with 1mg/ml Collagenase B (Roche) for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... human vimentin immunohistochemical staining of the paraffin sections was performed by using the Ventana Discovery XT instrument (Roche) with Ventana DAB Map detection Kit (760-124 ...
-
bioRxiv - Genomics 2020Quote: ... Note that this exome capture kit generates much less discordantly mapped read pairs than the kit from Roche (2 versus 22, compare with Figure 2). Accordingly ...
-
bioRxiv - Genomics 2022Quote: ... Positivity of SARS-CoV-2 infection was assessed both by PCR and measurement of specific antibodies (Cobas-Roche using Elecsys Anti-SARS-CoV-2 S). All patients gave their consent for participation in this study ...
-
bioRxiv - Biochemistry 2021Quote: ... except that all digests contained 200 µg/mL fibrils and 40 µg/mL pronase E and that the digest was stopped in each 20 µL aliquot with 2 µL protease inhibitor cocktail solution (1 tablet cOmplete EDTA-free Protease Inhibitor Cocktail, Roche, in 2 ml pure water) instead of PMSF solution ...
-
bioRxiv - Immunology 2023Quote: ... only donors were included that had no history of COVID-19 as well as had tested negative in three serological assays (EuroImmun-Anti-SARS-CoV-2 ELISA IgG /S1/, Siemens Healthineers SARS-CoV-2 IgG /RBD/, and Roche Elecsys Ig /Nucleocapsid Pan Ig/). PBMC were selected from heparinized full blood by a standard density gradient (Pancoll Separating Solution ...
-
bioRxiv - Neuroscience 2019Quote: ... barcoded and enriched using the NimbleGen SeqCap EZ Human Exome Library v2.0 enrichment kit (Roche NimbleGen, Madison, WI, USA). Purified and quantified library pool was subsequently sequenced on an Illumina HiSeq 2000 sequencing instrument (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... and human acute promyelocytic leukemia cell line NB4 (ATCC) were washed once with the digestion buffer for neuraminidase (Roche), the cells were centrifuged at 2000 rpm for 5 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 ng of nick translated probe per coverslip was combined with 12 μg of human Cot-1 DNA (Roche), 10 μg salmon sperm ssDNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... and NexCreERT2::R26R-tdT male mice received intraperitoneal injections (i.p.) of recombinant human (rh)EPO (5000 IU/kg body weight; NeoRecormon, Roche) or PL (solvent solution ...
-
bioRxiv - Neuroscience 2023Quote: Human induced pluripotent stem cell (iPSC) line KYOU-DXR0109B (ATCC) was routinely cultured on growth-factor reduced Matrigel (Roche) in mTeSR1 culture medium (StemCell Technologies ...