Labshake search
Citations for Roche :
351 - 400 of 2915 citations for 8 FLUORO 4H THIENO 3 2 C CHROMENE 2 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... using 2× Lightcycler 480 probes master (Roche, Indianapolis, IN) for IPO8 and Maxima SYBR Green/ROX qPCR Master Mix (2X ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 mM DTT and 1 × cOmplete protease inhibitors (Roche) and sonicated for 15 minutes total time (10s on/20s off ...
-
bioRxiv - Immunology 2023Quote: ... Elecsys® Anti-SARS-CoV-2 S from Roche for the in vitro quantitative determination of antibodies (including IgG ...
-
bioRxiv - Genetics 2023Quote: ... KAPA HiFi HotStart PCR Ready Mix (2×) (Roche, KK2601) was used as polymerase for all the PCR amplification steps in this paper ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mM 2-mercaptoethanol) with protease inhibitor cocktail (Roche) and 2 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Systems Biology 2023Quote: ... 2 mM EDTA) supplemented with Protease Inhibitor (Roche,11836170001) and homogenized with ∼60 gentle strokes ...
-
bioRxiv - Developmental Biology 2023Quote: ... 12.5 μL KAPA HiFi Hot-Start ReadyMix (2×, Roche); sterile water ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 mM ATP) containing phosphatase inhibitor (PhosphoStop, Roche Diagnostics) as described previously (19) ...
-
bioRxiv - Pathology 2023Quote: ... 2 mg/mL Dispase II (Roche Applied Biosciences, 4942078001), BSA Fraction V (Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... and 10 ng/ml recombinant human IL-2 (Roche). For activation of murine CD4+ T cells ...
-
bioRxiv - Microbiology 2023Quote: ... 2× KAPA HiFi HotStart DNA Polymerase ReadyMix (Roche, Switzerland), and 0.5 μM for each of the forward and reverse primers ...
-
bioRxiv - Microbiology 2023Quote: ... 2× KAPA HiFi HotStart DNA Polymerase ReadyMix (Roche, Switzerland), and 0.2 μM for each of the forward and reverse primers ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... sections were incubated with 2% NBT/BCIP solution (Roche) in darkness at 4 °C overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were blocked with 2% blocking reagent (Roche) and 5% normal goat serum in MAB for 30 min at RT and incubated with alkaline phosphatase-conjugated anti-DIG antibody (1:10000 for oxt ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 mM EDTA) with protease inhibitor cocktail (Roche, Switzerland) and manually homogenized on ice ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 % (v/v) glycerol and protease inhibitor cocktail (Roche Complete protease inhibitor cocktail ...
-
bioRxiv - Systems Biology 2023Quote: ... and digested with collagenase D (2 mg/ml; Roche) in RPM 1640 (Sigma-Aldrich ...
-
Activation of XBP1s attenuates disease severity in models of proteotoxic Charcot-Marie-Tooth type 1BbioRxiv - Neuroscience 2024Quote: ... 2% SDS) containing protease inhibitor cocktail (PIC 100X, Roche) and phosphatase inhibitors (Roche) ...
-
bioRxiv - Immunology 2024Quote: ... collagenase P 2 mg/mL (Roche, Mannheim, Germany, #11213857001), then carefully removed ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 mM sodium orthovanadate and protease inhibitors (Roche, #1697498)] was used to homogenize the brain samples ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 mM EDTA and cOmplete mini-protease inhibitor (Roche)) for 10 min rocking on a nutator at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 mM EDTA and cOmplete mini-protease inhibitor (Roche)) ...
-
bioRxiv - Neuroscience 2023Quote: ... tissue sections (3-5μm) from frontal cortex (BA 8/9) using the Nexes station automated system (Ventana Medical System Inc., Roche). Deparaffinised and rehydrated sections were pretreated and blocked ...
-
bioRxiv - Biochemistry 2021Quote: Cardiac myofibrils were prepared from left ventricular trabecular strips pre-stretched overnight to a sarcomere length of about 2 µm in rigor buffer (20 mM HEPES pH 7, 140 mM KCl, 2 mM MgCl2, 2 mM EGTA, 1 mM DTT, Roche complete protease inhibitor) at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... washed with cold PBS and lysed for 20 minutes at 4°C in lysis buffer (10mM Tris pH 8, 10mM NaCl, 0.2% NP-40, supplemented with cOmplete proteinase inhibitors (Roche)) prior to snap freezing in 1ml lysis buffer on dry ice ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Genomics 2021Quote: ... and then resuspended in Antibody buffer (10 mM HEPES pH 150 mM NaCl, 2 mM spermidine, 2 mM EDTA, 0.1% BSA, and Roche complete EDTA-free protease inhibitor) with primary anti-Pol2S5p antibody (Cell Signaling Technology cat ...
-
Polo-like kinase 1 independently controls microtubule-nucleating capacity and size of the centrosomebioRxiv - Cell Biology 2020Quote: ... 2 mM MgCl2 and EDTA-free protease inhibitor cocktail (Roche)) and lysed in an ice-cold sonicating water bath for 5 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... 25 μl of 2× HIFI HotStart Ready Mix (Kapa Biosystems), and 0.2 M SMART PCR Primer and polymerase chain reaction (PCR ...
-
bioRxiv - Molecular Biology 2019Quote: ... PMSF with 2 cOmplete protease inhibitor cocktail tablets (Roche 04693116001) per 50 mL of buffer) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μg/ml RNase A and protease inhibitor mixture (Roche). Proteins were bound to GST resin (GE Healthcare ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μg/ml Rnase A and protease inhibitor tablets (Roche)) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 mM TCEP and a cocktail of protease inhibitors (Roche) using a syringe fitted with a 26G ½ needle ...
-
bioRxiv - Immunology 2019Quote: ... supplemented with 2% FCS and 1mg/mL dispase II (Roche) overnight at 4°C ...
-
bioRxiv - Systems Biology 2019Quote: ... 2% SDS and protease inhibitors (complete mini., EDTA-free; Roche). Cells were lysed by sonication ...
-
bioRxiv - Genomics 2021Quote: ... 0.0075% DIG and 2 U/ul Protector RNase inhibitor (Roche)) for 1 min on ice ...
-
bioRxiv - Developmental Biology 2020Quote: ... The embryos were blocked with 2% Blocking Reagent (Roche, Mannheim) for 1h ...
-
bioRxiv - Neuroscience 2020Quote: ... and 10 ng/mL fibroblast growth factor 2 (FGF2, Roche). Oligodendrocyte precursor cells were removed by brusquely shaking the culture flasks several times when changing the medium after 2 or 3 days ...
-
bioRxiv - Immunology 2019Quote: ... and 60 U/mL human IL-2 (Proleukin, Roche Diagnostics). The A20 cells were grown in RPMI-1640 (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% Triton X-100) with 2% complete protease inhibitor (Roche) for 15 min on ice ...
-
bioRxiv - Neuroscience 2021Quote: ... and a phosphatase inhibitor cocktail (2×PhosSTOP from Roche Diagnostics). Proteins were quantified using the Bio-Rad DC Protein assay (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2% SDS) in the presence of cOmplete and PhosSTOP (Roche). Protein-containing supernatants were pre-cleared for 1 h at 4°C with Dynabead® protein G (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 60 U/mL human IL-2 (Proleukin, Roche Diagnostics). The F9 teratocarcinoma cells were grown in DMEM (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.1% 2-mercaptoethanol) in the presence of protease inhibitors (Roche) and phosphatase inhibitors (1 mM sodium orthovanadate ...
-
bioRxiv - Cell Biology 2021Quote: ... PMSF (2 mm) and Protease Inhibitor Tablet (Roche, Basel, Switzerland), RNase A (1 mg·mL−1 ...
-
bioRxiv - Cell Biology 2021Quote: ... PMSF (2 mm) and Protease Inhibitor Tablet (Roche, Basel, Switzerland), RNase A (1 mg·mL−1 ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 mM EDTA pH 8.0) containing Protease Inhibitor Cocktail (Roche). Nuclei were lysed using a Misonix XL-2000 Probe Sonicator with 5-10 second ON / 20 second OFF intervals until the lysate was clear (2 rounds for P0 ...
-
bioRxiv - Immunology 2022Quote: ... 2 mM EDTA and 10% glycerol with protease inhibitors (Roche) and phosphatase inhibitors (Sigma ...
-
bioRxiv - Bioengineering 2022Quote: ... The lungs were inflated with dispase (2 U/mL; Roche) in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 60 U/mL human IL-2 (Proleukin, Roche Diagnostics). The F9 teratocarcinoma cells were grown in DMEM (Gibco ...