Labshake search
Citations for Roche :
201 - 250 of 7910 citations for 8 Benzyloxy 5 R 2 bromo 1 hydroxyethyl 1H quinolinone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... 2 μg ml−1 DNaseI (Roche), and protease inhibitor cocktail (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... in 5 mg ml−1 dispase (Roche) and 0.1 mg ml−1 DNase I (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... electrophoresed at 100V for 1h and transferred to positively-charged nylon membrane (Roche, Indianapolis, IN) using a Vacuum Blot System (Bio-Rad ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were then washed with ice-cold PBS two times and lysed in 300 μl RIPA buffer (50 mM TRIS pH 8, 150 mM NaCl, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mM EDTA, Roche Complete protease inhibitors ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were then washed with ice-cold PBS two times and lysed in 300 μl RIPA buffer (50 mM TRIS pH 8, 150 mM NaCl, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mM EDTA, Roche Complete protease inhibitors ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% glycerol and 2 mM Dithiothreitol (DTT)) supplemented with protease inhibitor cocktail (Roche) and lysed by sonication on ice ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM β-mercapto-ethanol) supplemented with 5 μg/ml DNase I (Roche) and lysed using a homogenizer (Avestin Emulsiflex C5 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.15M NaCl) for 1 hour at R/T and then incubated with anti-DIG antibody (Roche; 1:5000) overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5 % NP40, 2.5 mM EDTA, 0.05 % NaDeoxycholate, 20 mM Tris-HCl pH 8, 1x of PhosSTOP, 1x Roche protease inhibitor mixture), and the TE buffer (same as for histones plus 1x PhosSTOP) ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were harvested with a cell scraper and lysed by adding 2 x TNI buffer 8 containing complete Ultra protease inhibitor (Roche) and Halt phosphatase inhibitor (Pierce) ...
-
bioRxiv - Cell Biology 2019Quote: ... washed in PBS, and resuspended in Lysis Buffer (Tris 10 mM pH 8, 2 mM EDTA) supplemented with Complete protease inhibitor (Roche, Merck ...
-
bioRxiv - Immunology 2023Quote: ... Cells were lysed in lysis buffer (2% SDS in 50 uM Tris-HCL pH.8, supplemented with EDTA-free protease inhibitor, Roche) at cell concentration of 20×106/mL and incubated at 95 °C for 15 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... the cell pellets resuspended in lysis buffer (purification buffer 50 mM Tris pH 8, 50 mM NaCl, 2 mM DTT; + cOmplete EDTA-free Protease Inhibitor (Roche)) and lysed by sonication ...
-
bioRxiv - Systems Biology 2023Quote: ... HepG2s were washed once with 1X PBS then lysed in SDS lysis buffer (50 mM Tris HCl/2% SDS/5% glycerol/5 mM EDTA/1mM NaF/dH2O) supplemented with cOmplete Protease Inhibitor Cocktail Tablets (Roche #11836170001), Phosphatase Inhibitor Cocktail 2 (Sigma-Aldrich® #P5726) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Clones grown from sorted cells were expanded and DNA samples from individual clones were extracted with Lucigen quick DNA buffer (68 °C for 15 min followed by 98 °C for 2 min), and genotyped by PCR with primers (F: GGTCCCCTTGGAACTTCATGC, R: CCTTCAACAACTAATAGCAGGG) with 2x KAPA HiFi HotStart ReadyMix (Roche) using the following PCR program (95 °C for 3 min ...
-
bioRxiv - Bioengineering 2021Quote: Second-round library PCR (Fig. 1H) was performed using Kapa HiFi Hotstart Readymix (KK2602, KAPA Biosystems) in 100 μl reaction volume with 10 μl of 2 nM first-round PCR product as a template and forward (AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GAC GCT CT*T *C ...
-
bioRxiv - Biophysics 2022Quote: ... Frozen bacteria containing full-length or ΔUBLΔUBA UBQLN constructs were resuspended in Buffer A (50 mM Tris pH 8, 1 mM MgCl2, 1 mM PMSF, and 0.2 mg/mL DNase I and Roche Complete Mini protease inhibitor cocktail) ...
-
bioRxiv - Genomics 2022Quote: ... before being re-pelleted by centrifuging for 3 minutes at 4°C at 500g and resuspended in 180µl TMS buffer (10mM Tris-HCl pH 8, 1mM MgCl2, 1% SDS, 1× Complete Protease Inhibitor Cocktail (PIC, Roche)) with 0.4µl benzonase (E1014 ...
-
bioRxiv - Systems Biology 2022Quote: ... 6 mM MgCl2, 1 mM EDTA, 100 mM NaCl, 0.1% Tx-100, pH 8, and 1× Protease Inhibitor Cocktail, Roche) at 4°C ...
-
bioRxiv - Neuroscience 2019Quote: ... Striatum and ventral midbrain from injected and non-injected hemispheres were rapidly dissected and homogenized with 6 volumes of Triton lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 5% glycerol, 1% Triton-X100, 1 mM EDTA, 1X EDTA-free Complete protease inhibitor cocktail [Roche] and 1X phosphatase inhibitor cocktail 2 and 3 [Sigma]) ...
-
bioRxiv - Neuroscience 2022Quote: ... pH 7.5, 150 mM NaCl, 5% glycerol, 1% Triton X-100, 1□mM EDTA, 1X Complete Mini protease inhibitor cocktail [Roche]). Tissues were disrupted using a mechanical homogenizer (IKA T10 basic ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mM KCl, 10mM MgCl2, 1 mM PMSF, 5 mM Na3VO4, 5 mM NaF, 1 mM TCEP, cOmplete Protease Inhibitor Cocktail, Roche) in 2 steps ...
-
bioRxiv - Plant Biology 2021Quote: ... Amplification involved cDNA (2 μl, 5 ng/μl) in optical 384-well plates (Roche Light Cycler 480 ...
-
bioRxiv - Plant Biology 2020Quote: ... 5 hours incubation in MTSB containing 2 % BSA containing either an anti-GFP (Roche) or an anti-PIN1 monoclonal antibody at 0.1 % ...
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were stained with 5 mg/ml 41,6-diamidino-2-phenylindole (DAPI; Roche, 1023627600) in PBS for 1 min and coverslips were mounted onto SuperFrost® Plus slides (R ...
-
bioRxiv - Immunology 2020Quote: ... About 2-5 μg of RNA were treated with DNAseI (Roche Diagnostics, Laval, QC) according to the product manual ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 8) containing 1 mM PMSF and Complete™ EDTA free protease inhibitor cocktail (Roche). Nuclei were removed by centrifugation for 1 min at 6,000 rpm ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 20 mM Tris pH 8) supplemented with 1 mg/mL of protease inhibitors (Roche). Cell lysates were sonicated for 10 cycles with Bioruptor Pico (Diagenode ...
-
bioRxiv - Cell Biology 2019Quote: ... with ATP standard solutions used at concentrations between 10−8 and 10−5 M (luciferin/luciferase ATP bioluminescence assay kit CLSII, Roche, Basel, Switzerland). Data are expressed as nmol ATP produced/min/106 cells.
-
bioRxiv - Microbiology 2020Quote: ... were amplified using primers Sb.1 - Sb.2 and Sb.3 to Sb.8 (Table 2) and labeled with digoxigenin (DIG) using the PCR DIG probe synthesis kit (Roche Diagnostics). Membranes were hybridized with these probes at 65°C and then washed at 68°C with decreasing concentrations (from 2X to 0.2X ...
-
bioRxiv - Plant Biology 2020Quote: ... glycerol 25%, KCl 20 mM, EDTA 2 mM, MgCl2 2.5 mM, Sucrose 250 mM, DTT 5 mM, protease inhibitor Roche™, 1 tablet/ 50 mL) at a ratio of 1:3 (w/v) ...
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... 1% NP-40, 0.5% sodium deoxycholate, 1 mM EDTA pH 8 and 1 tablet of protease inhibitor cocktail Roche cOmplete (Roche, Basel, Switzerland) and 1 tablet of phosphatase inhibitor PhosSTOP (Roche)) ...
-
bioRxiv - Biochemistry 2023Quote: ... and collected by centrifugation at 7,500 RCF for 15 minutes and then suspended in Lysis Buffer D (20 mM HEPES pH 8, 200 mM NaCl, 5 mM imidazole, 0.5 mM Imidazole, 1x Roche EDTA free protease inhibitor). Cells were lysed using an emulsifier (AvestinEmulsiflexC3 ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were suspended in Resuspension Buffer A (20 mM HEPES pH 8, 150 mM NaCl, 5% glycerol, 0.5 mM TCEP, Roche EDTA free protease inhibitor) and lysed using an emulsifier (AvestinEmulsiflexC3) ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 mM CaCl2, 5 mM EGTA, 50 mM sucrose, 0.1% Triton X-100, 1/2 tablet of cOmplete inhibitor [Roche], and 2.5 U/mL Benzonase [Novagen]), lysed by sonication ...
-
bioRxiv - Microbiology 2020Quote: ... pH 8) supplemented with protease inhibitors (1 tablet of complete protease inhibitor per 20 mL; Roche, Mannheim ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µL of LC480 SYBR Green I Master (2 X conc. Roche, Product No. 04887352001), 0.1 µL each of forward and reverse primers (20 µM ...
-
bioRxiv - Microbiology 2020Quote: ... Nuclei were counterstained with 5 ng/ml of 4,6–diamidino-2-phenylindole dihydrochloride (DAPI; Roche). Coverslips were mounted on slides with Fluoromount G (Electron Microscopy Sciences ...
-
bioRxiv - Biophysics 2020Quote: ... 5 mM MgCl2 (buffer B) containing 2 mM PMSF and Complete protease inhibitor cocktail (Roche). After centrifugation ...
-
bioRxiv - Microbiology 2020Quote: ... Nuclei were counterstained with 5 ng/ml of 4,6–diamidino-2-phenylindole dihydrochloride (DAPI; Roche). Coverslips were mounted on slides with Fluoromount G (Electron Microscopy Sciences ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 mM TCEP and 5 % glycerol) supplemented with cOmplete EDTA-free protease inhibitor complex (Roche) and ribonuclease A (Roche) ...
-
DTX3L and USP28 fine-tune DNA double strand repair through mutual regulation of their protein levelsbioRxiv - Biochemistry 2023Quote: ... 1% Triton X-100, 2 mM EDTA, 2 mM EGTA, 1 mM PMSF, and complete protease inhibitor cocktail tablet; Roche), incubated with continuous shaking at 4°C for 20 min and then centrifuged at 12 000xg at 4°C for 15 min ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μl of pyrophosphatase at 5 μg/ml (Roche), 4 μl of 1 mg/mL T7 RNA polymerase and 20 μl of transcription buffer 5X (Hepes pH7.5 400 mM ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 mM KCl) with 1% protease inhibitor cocktail (Roche), 1% phosphatase inhibitor cocktail (Roche ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1% deoxycholate) and 5% protease inhibitor cocktail (Roche, Germany). Whole cell extracts were incubated at 4°C for 30 min on a shaker ...
-
bioRxiv - Genomics 2023Quote: ... protease inhibitors (1 tablet per 5 mL, Roche 4693159001)) was added to the embryo pellet ...
-
bioRxiv - Immunology 2023Quote: ... Following antibodies were diluted in 1-5% BSA (Roche): anti-cGAS (Cell Signaling ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 5 mM type 1 collagen (Roche Diagnostics) to allow spheroid formation and seeded onto the ULA plates at a concentration of 5 × 103 cells per well ...
-
bioRxiv - Developmental Biology 2022Quote: ... 25 million cells were resuspended in 1 ml lysis buffer (1% SDS, 50 mM Tris-HCl pH 8, 20 mM EDTA, 1x cOmplete (Roche, 4693132001) protease inhibitor) ...
-
bioRxiv - Genetics 2023Quote: ... 25-30 million cells were resuspended in 1 mL lysis buffer (1% SDS, 50 mM Tris-HCl pH 8, 20 mM EDTA, 1x cOmplete (Roche, 4693132001) protease inhibitor) ...