Labshake search
Citations for Roche :
551 - 600 of 3704 citations for 8 BROMO 2 3 4 5 TETRAHYDRO 1H PYRIDO 4 3 B INDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... qPCR mastermixes were prepared with 4 μl Light Cycler Enzyme Mix (Roche, Germany), 0.6 μl 10 μM primer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 200 μl/ml of a 4% stock solution of blocking reagent (Roche 11096176001) which was dissolved and autoclaved in MNT solution (150 mM maleic acid pH 7.5 ...
-
bioRxiv - Immunology 2023Quote: ... Macrophages were polarized with 20 ng/mL recombinant IL-4 (Peprotech or Roche) or 100 ng/mL LPS (E ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4 mM Sodium Orthovanadate and supplemented with protease inhibitors (Complete protease inhibitors, Roche). After a 20min incubation on ice ...
-
bioRxiv - Cell Biology 2022Quote: ... MEFs were incubated for 4 h with 10 ng/ml colcemid (Roche, 10295892001). Cells were then collected and incubated for 15 min at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4 mM EDTA) supplemented with cOmplete Mini EDTA-free protease inhibitor cocktail (Roche). Proteins were resolved on a 4%–12% bis-tris gel (Invitrogen) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 4 ng of ChIP DNA with KAPA Library Preparation Kit (KAPA Biosystems) and NimbleGen SeqCap Adaptor Kit A or B (Roche ...
-
bioRxiv - Developmental Biology 2024Quote: ... AP reaction was developed with 4-Nitro blue tetrazolium chloride (NBT, Roche, 11383213001) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP ...
-
bioRxiv - Cell Biology 2023Quote: ... fibroblasts were fixed with PFA 4 % and stained with DAPI (Roche; 1:10,000) for 5 min ...
-
bioRxiv - Microbiology 2022Quote: ... and lentivirus vectors at a 2:8:10 μg ratio to HEK293T cells using Xtreme-Gene9 (Roche) and lentivirus-containing supernatants were collected 72hr post-transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 0.1 mM EDTA (pH 8)) supplemented with 2 mM Na3VO4 and complete protease inhibitor mixture (Roche). Lysates were first centrifuged at 4 °C for 15 min at 20.000 g and subsequently subjected to ultracentrifugation at 4° C for 30 min at 100.000 g ...
-
bioRxiv - Molecular Biology 2021Quote: ... digested rotating for 1h at 37°C with 2mg/ml Collagenase/Dispase (Roche) and then filtered twice (100 μm ...
-
bioRxiv - Biophysics 2023Quote: ... the lysate was incubated for 1h with cOmplete His-Tag Purification Resin (Roche) at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... the DNA template was degraded by 1h incubation with 0.2U/µL DNaseI (Roche). Transcription products were loaded on a 1 mL G-25 Superfine Sephadex column (Cytiva ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 2) 5 10^6 copies of bacteriophage MS2 RNA (Roche) were spiked in per isolation ...
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Cell Biology 2022Quote: ... HeLa cells were reverse transfected with 1:3 or 1:6 X-tremeGENE 9™ (Roche) transfection reagent according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Systems Biology 2023Quote: ... 500 mM NaCl and 3 mM Dithiothreitol (DTT)) supplemented with 1 mg deoxyribonuclease I (DNaseI, Roche) and protease inhibitor 4-(2-Aminoethyl ...
-
bioRxiv - Immunology 2023Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated in digestion solution (3 mg/mL collagenase D [Roche] in DMEM/F-12 [Gibco]) for 45 min at 37 °C with intermittent vortex mixing to dislodge soft tissues ...
-
bioRxiv - Cell Biology 2024Quote: ... with primer set #3 (Supplementary Table 1) using KAPA High-Fidelity DNA Polymerase (KAPA Biosystems, KE2502). The forward and reverse primers contained BspEI and KpnII sites respectively ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were resuspended and washed twice in 3 ml Red Blood Cell Lysis Buffer (Roche) to remove any visible blood cells ...
-
bioRxiv - Cell Biology 2020Quote: ... Monoclonal (3F10) antibody directed against the HA epitope and monoclonal (B-2) antibody against GFP were purchased from Roche and Santa Cruz Biotechnology (Dallas ...
-
bioRxiv - Cell Biology 2019Quote: Zebrafish samples for Western blot analysis were deyolked and directly lysed in 2x Laemmli Sample Buffer containing 5% b-ME and a PhosSTOP tablet (Roche), 10 ul per embryo unless otherwise indicated ...
-
bioRxiv - Cell Biology 2019Quote: ... HUVEC cells for Western blot analysis were lysed directly in 2x Laemmli Sample Buffer containing 5% b-ME and a PhosSTOP tablet (Roche), 500ul per T-25 culture flask.
-
bioRxiv - Cell Biology 2020Quote: ... anti-SPD-5 (1:1000, a generous gift from B. Bowerman, Hamill et al., 2002) and anti-GFP (1:500, Roche) overnight at 4°C and with secondary antibodies Alexa488 (1:500 ...
-
bioRxiv - Plant Biology 2019Quote: ... 4% (w/v) polyvinylpyrrolidone) supplemented with 2x protease inhibitor cocktail without EDTA (#11873580001, Roche) for 1 h at 4°C in an Eppendorf ThermoMixer at 2000 rpm ...
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos were incubated overnight at 4 °C in MABB with anti-fluorescein POD (Roche) at a 1:500 dilution ...
-
bioRxiv - Neuroscience 2019Quote: ... Signals were developed using a mixture of 4-Nitro blue tetrazolium chloride (Roche, 11383213001) and BCIP 4-toluidine salt solution (Roche ...
-
bioRxiv - Neuroscience 2020Quote: ... lysates were incubated at 4 °C overnight with rabbit anti-GFP (1:1000, Roche) and pull down was performed with magnetic proteinA beads (Millipore ...
-
bioRxiv - Neuroscience 2020Quote: ... 4% V/V glycerol and Complete Mini Protease inhibitor cocktail tablets (Roche, Basel Switzerland), 1 tablet in 10 mL) ...
-
bioRxiv - Pathology 2021Quote: ... Obex samples had 4 µl of 1000 µg/mL of proteinase K (PK, Roche) (diluted in 1x PBS and 0.5 M EDTA ...
-
bioRxiv - Molecular Biology 2022Quote: ... the mutants were extracted with PBS containing 4 mM digitonin and protease inhibitors (Roche).
-
bioRxiv - Microbiology 2020Quote: ... The membrane was then incubated overnight at 4°C with an anti-GFP (ROCHE Anti-GFP ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 mM DTT and 10 % (v/v) glycerol) supplemented with: cOmplete protease inhibitor (Roche), 1 mM PMSF ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were incubated overnight at 4 °C in MABB with anti-DIG POD (Roche) at a 1:1,000 dilution ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was reverse-transcribed using 2.5×10-4 U/μl hexanucleotide mix (Roche), 0.4mM deoxynucleotide mix (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and digested with digestion buffer (Gibco DMEM/F12, Fisher 11320033; 4 µg/ml Roche Collagenase/Dispase ...
-
bioRxiv - Biochemistry 2024Quote: ... tissues were lysed in RIPA buffer (ratio 1:4) supplemented with protease inhibitors (Roche) and protein was quantified by BCA Protein Assay Kit assay.
-
bioRxiv - Genomics 2024Quote: ... and incubated overnight at 4°C with Anti-Dig-AP antibody (Roche, 1:5000) in 1% lamb serum ...
-
bioRxiv - Plant Biology 2020Quote: ... Protein extraction buffer (60 mM Tris-HCl [pH 8.8], 2% [v/v] glycerol, 0.13 mM EDTA [pH 8.0], and 1 × protease inhibitor cocktail complete from Roche) was added to the homogenized tissues (100 μl/10 mg) ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extraction buffer (60 mM Tris-HCl [pH 8.8], 2% [v/v] glycerol, 0.13 mM EDTA [pH 8.0], and 1× protease inhibitor cocktail complete from Roche) was added to the homogenized tissues (100 µl/10 mg) ...
-
bioRxiv - Plant Biology 2022Quote: ... Protein extraction buffer (60 mM Tris-HCl [pH 8.8], 2% [v/v] glycerol, 0.13 mM EDTA [pH 8.0], and 1× protease inhibitor cocktail complete from Roche) was added to the homogenized tissues (100 µl/10 mg) ...