Labshake search
Citations for Roche :
251 - 300 of 2421 citations for 8 4 Chlorophenylthio guanosine 3' 5' cyclic Monophosphate triethylammonium salt since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Developmental Biology 2023Quote: ... with 8% PFA in PBS supplemented with phosSTOP (Roche) for 1 hour at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... The extract was then supplemented with 1x DNAse salt solution and 100 U DNAse I (Roche) and incubated for 30 min at 4 °C on rotator ...
-
bioRxiv - Cancer Biology 2021Quote: ... superoxide dismutase activity was measured using a water-soluble tetrazolium salt (WST-1) (purchased from Roche) after drug treatment for 3 days ...
-
bioRxiv - Cell Biology 2022Quote: ... High salt buffer (KCL, NaCl, Tris-HCl, 0.5M EDTA, Triton X-100, ddH2O) with phosphatase (Roche) and protease (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... 0.2 μL of each primer (100mM stock) (Table SI-4) and 5 μL of 2× KAPA SYBR Fast Universal qPCR kit (KAPA Biosystems, USA). Samples were cycled (40 cycles ...
-
bioRxiv - Plant Biology 2019Quote: ... The fine powder was resuspended with the extraction buffer (50 mm Tris, pH 8, 8 M urea, and 0.5% SDS) supplemented with protease inhibitor (Roche Diagnostics GmbH, Mannheim, Germany), and homogenized with a Dounce homogenizer ...
-
bioRxiv - Biophysics 2021Quote: ... 3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate (CHAPS, Roche Life Sciences, Indianapolis, IN) micelles and also using 1,2-dihexanoyl-sn-glycero-3-phosphocholine (DHPC)/1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC ...
-
bioRxiv - Immunology 2023Quote: ... 3 mM ATP (Roche), 25 μg/ml MSU (InvivoGen) ...
-
bioRxiv - Plant Biology 2021Quote: ... was isolated from the cDNA of juvenile cluster root tissues from P-deficient plants using the 5’/3’ RACE Kit (2nd generation, Roche Diagnostics S.p.a., Monza, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR primer for generating the probe was 5’-GGTTCTGTGATTGAGTGTTTGGATCTCCCTGCG-3’ with a single-end CY3 tag generated using the DIG RNA Labeling Kit (Roche Applied Science, Penzberg, Germany) based on the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and phoC-A-R1 (5’-CAA CAT CGC TTT GCC AGT G-3’) (Fraser et al., 2017) with a Roche LightCycler® 96 (Roche Diagnostics, Mannheim, Germany) using 5 µL KAPA SYBR FAST 2x qPCR Master Mix (KAPA Biosystems ...
-
bioRxiv - Genomics 2020Quote: ... Pellets were resuspended in 10 mL of L2 buffer (200mM NaCl 1mM EDTA pH 8 0.5mM EGTA 10mM Tris, pH 8, dH2O, 1 protease inhibitor tablet (Roche Complete cat #1 697 498) per 50ml buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... beads were resuspended in low-salt rinse buffer (20 mM HEPES, pH7.5, 0.5 mM spermidine, a Roche mini-complete tablet per 10 ml and 0.05% Digitonin) ...
-
bioRxiv - Cell Biology 2021Quote: ... and digested in Han s’ balanced salt solution containing 0.18 units/mL collagenase (10 mg/mL; Roche) for 45min at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... The cross-linking reaction was quenched by incubating the cells with 0.125 M glycine for 5 min with mild agitation at room temperature followed by centrifugation at 3,000 rpm for 5 min at 4°C with a subsequent PBS wash (containing 0.01X protease inhibitor cocktail or PIC; #11836170001, Roche Applied Science, Indianapolis, USA). Following the complete removal of PBS ...
-
bioRxiv - Microbiology 2019Quote: ... 8 mM EDTA) with Complete™ protease inhibitor cocktail (Roche). The Triton X-100-insoluble material was pelleted twice by centrifugation (10 min at 16,000 g) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and phenol (phenol-Tris saturated, pH 8; Roche, Indianapolis, IN) and chloroform:isoamyl alcohol (American Bioanalytical ...
-
bioRxiv - Biochemistry 2022Quote: ... pH=8) supplemented with EDTA-free protease inhibitor mixture (Roche) and 100 mM PMSF ...
-
bioRxiv - Microbiology 2023Quote: ... and suspended in 8 M urea containing PhosSTOP (Roche Diagnostics) and Benzonase (Novagen) ...
-
bioRxiv - Biophysics 2023Quote: Microchambers were incubated with 8 mg/µl anti-digoxigenin (Roche) at 25°C for 90 min and then the blocking buffer (PBS with 1% α-casein ...
-
bioRxiv - Cancer Biology 2020Quote: ... All the signals were visualized by adding 3-3′-Diaaminobenzidinetetrahydrochloride (DAB substrate) solution (Roche) to the slides and counterstained with haematoxylin ...
-
bioRxiv - Biophysics 2021Quote: ... Sf9 cell pellets were resuspended in low salt buffer (50 mM HEPES, pH 7.5, 50 mM NaCl, 0.5 mM EDTA and protease inhibitor cocktails (Roche) and lysed by Dounce homogenization (∼30 strokes) ...
-
bioRxiv - Biochemistry 2022Quote: ... The resulting pure nuclear pellet was first resuspended with 70 μL low salt buffer (20 mM HEPES, pH 7.6, 1.5 mM MgCl2, 10 mM KCl, 25% glycerol, protease inhibitor (Roche)) and 2.5 μL benzonase (Sigma ...
-
bioRxiv - Molecular Biology 2019Quote: ... High Salt buffer (50 mM HEPES pH 7.5, 500 mM NaCl, 1% Triton X-100, 1x protease (Roche) and phosphatase inhibitors (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2022Quote: ... with modifications - membranes were pre-hybridized in a volume of 0.2ml of pre-hybridization solution (5xSSC, 0.1% N-Lauroylsarcosine sodium salt, 1% SDS, 2% Blocking reagent (Roche)) for each 1cm2 of the membrane ...
-
bioRxiv - Neuroscience 2021Quote: ... Nematodes were resuspended in 8 M urea in 100 mM TRIS-HCl buffer (pH 8) containing cOmplete™ protease inhibitor cocktails (Roche Diagnostic Canada, Laval, QC, Canada) and aliquoted into reinforced 1.5 mL homogenizer tubes containing 500 μm glass bead homogenizer tubes with 25 mg of glass beads ...
-
Evolutionary conserved aspects of animal nutrient uptake and transport in sea anemone vitellogenesisbioRxiv - Evolutionary Biology 2022Quote: ... and 3% Blocking Reagent (Roche) to the hybridization mix during overnight blocking and hybridization of the probe ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 3% Blocking Reagent (Roche) to the hybridization mix during overnight blocking and hybridization of the probe ...
-
bioRxiv - Cancer Biology 2021Quote: ... 20mM Tris-HCl pH 8) supplemented with protease inhibitors (Roche, 04693116001), followed by a final washing step with TE 1X buffer ...
-
bioRxiv - Biochemistry 2019Quote: ... pH 8) containing complete protease inhibitor (in 50ml) cocktail (Roche Molecular) and disintegrated with a French press (1100 psi) ...
-
bioRxiv - Cell Biology 2020Quote: ... the specimen was digested in 8 mg/mL Collagenase D (Roche) and 4.8 U/mL Dispase II (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 8] with EDTA-free Protease Inhibitor Cocktail (Roche, Basel, Switzerland) and were clarified by centrifugation ...
-
bioRxiv - Molecular Biology 2019Quote: ... all at pH 8) supplemented with a phosphatase (Roche, Basel, Switzerland) and protease inhibitor cocktail (Roche) ...
-
bioRxiv - Neuroscience 2019Quote: ... 8 U/ml RNAse inhibitor and a protease inhibitor cocktail (Roche). Cell debris and nuclei were removed by centrifugation at 1000 g for 10 min at 4°C yielding pellet P1 and supernatant S1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... pH 8 with added inhibitors (cOMPLETE™ tablets, EDTA-free, Roche), DNAse (1 mg/ml) ...
-
bioRxiv - Cancer Biology 2019Quote: ... with filters (8-μm pore size) pre-coated with fibronectin (Roche). APOC2 overexpressing cells ...
-
bioRxiv - Neuroscience 2021Quote: ... 20 mM Tris HCl pH 8 with protease inhibitor cocktail (Roche) and assayed for protein concentration by the BCA assay (Pierce) ...
-
bioRxiv - Biophysics 2023Quote: ... pH 8) with cOmplete EDTA-free protease inhibitor cocktail (11873580001, Roche), 70 µg/mL lysozyme (90082 ...
-
bioRxiv - Microbiology 2019Quote: ... Cells were lysed in 100 µl lysis buffer (5 ml contain: 10 mM Tris-HCl pH 7.5, 4% SDS, 1 PhosSTOP tablet [Roche], a scoop of DNase I [NEB]) for 5 min at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: Human tumor samples were collected on different days right after surgery and digested in Hank’s Balanced Salt Solution supplemented with 2 mg/mL collagenase A (Roche), 2.5 U/mL hyaluronidase (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: Cells were lysed in RIPA buffer or high-salt RIPA buffer supplemented with cOmplete EDTA-Free protease inhibitor (Roche) and PhosSTOP phosphatase inhibitor (Roche ...
-
bioRxiv - Developmental Biology 2019Quote: ... and finally in 1x low salt buffer without detergents (25 mM Tris pH 8.0, 150mM NaCl, 1x Protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Beads were washed with Low Salt buffer (50 mM HEPES pH 7.5, 140 mM NaCl, 1% Triton X-100, 1x protease (Roche) and phosphatase inhibitors (Sigma-Aldrich)) ...
-
bioRxiv - Immunology 2021Quote: ... brain and dura mater were chopped and subject to enzymatic digestion in Hanks’ Balanced Salt Solution (HBSS) containing 2.5 mg/mL collagenase D (Roche) and 0.1 mg/mL DNase I (Roche ...
-
bioRxiv - Cell Biology 2022Quote: all the samples were lysed with High Salt Buffer (50 mM Tris pH 7.5, 300 mM NaCl, 1% Triton X-100, Protease inhibitors (Roche), Phosphatase inhibitors Halt cocktail ...
-
bioRxiv - Cell Biology 2023Quote: ... Pellet was resuspended in high-salt buffer (750 mM NaCl, 10 mM Tris, pH 7.6, 1 mM EDTA, protease inhibitor tablet (Roche)) and lysed by sonication at 60% power using a probe sonicator (Branson sonifier 450 ...
-
bioRxiv - Immunology 2023Quote: Human lung tissue from deceased donors not used for transplant was resected and minced in Hanks’ Balanced Salt Solution (HBSS) buffer supplemented with 0.2% Collagenase (10103586001, Roche), 2000 U/ml DNase I (4716728001 ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’ RACE was performed with the 5’ RACE kit (Roche) using gene-specific reverse primers ...