Labshake search
Citations for Roche :
451 - 500 of 2577 citations for 8 3 5 DIMETHYL 4 METHOXYPHENYL 8 OXOOCTANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Nucleic acids were extracted using the High Pure Viral Nucleic Acid Kit (Roche) according to the manufacturer’s recommendations.
-
bioRxiv - Genetics 2020Quote: ... These pieces were then added to 3-4 ml of digestion media containing 0.1 mg/ml Liberase (Roche, 501003280), 100 U/ml DNase I (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... Myelin was washed by dilution in HBSS and centrifuged at 400 x g for 5 min at 4 °C before suspending in 3 mL ice cold 0.32 M sucrose solution containing protease inhibitor cocktail (Roche). Next ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA (3–4 μg) was used to prepare cDNA with the Transcriptor First-Strand cDNA synthesis kit (Roche). qPCR was performed with TaqMan gene expression assay primers (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 million cells were pre-extracted on ice with ice-cold 30 µl CSK buffer (25 mM HEPES pH 7.4, 50 mM NaCl, 1 mM EDTA, 3 mM MgCl2, 300 mM sucrose, 0.2% Triton X-100, 1 Roche cOmplete protease inhibitor cocktail tablet per 50 ml of buffer ...
-
bioRxiv - Microbiology 2023Quote: ... 1ml of CDP-Star® Chemiluminescent Substrate (Disodium 2-chloro-5-(4-methoxyspiro[1,2-dioxetane-3,2′-(5-chlorotricyclo[3.3.1.13.7]decan])-4-yl]-1-phenyl phosphate) (Roche, Cat No. 11685627001) was added to 9ml of DIG-detection buffer and membranes were then incubated with the substrate for 5 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... Isolated hepatocytes were seeded at a density of 4-500,000 and 1,000,000 cells in rat tail collagen I (5 μg/cm2, Roche) pre-coated 6-well plates and T25 flasks ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mL of the culture was then treated with either 5 µl of MeOH or LMB dissolved in 7:3 MeOH:H2O solution (Roche) at a final concentration of 50 ng/mL for 45 min before imaging.
-
bioRxiv - Cell Biology 2021Quote: ... Samples were then washed 3 times for 5 min each in PBST and blocked with 1X Blocking Reagent (Roche) in PBST ...
-
bioRxiv - Cell Biology 2020Quote: RACE-cDNA was synthesized according to the manufacturer’s protocol for 5’/3’ RACE Kit 2nd generation (Roche; Cat.No. 03353621001). The 2648-bp cDNA was cloned into the NheI-XhoI site in pcDNA 3.1 plasmid to obtain pcDNA3.1-DR5-AS and was verified by sequencing ...
-
bioRxiv - Physiology 2023Quote: ... according to the manufacturer’s protocol and were transcribed into cDNA with the 2nd generation 5’/3’ RACE Kit (Roche) in combination with the Expand High Fidelity PCR System (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... two PCR reactions were performed with PCR anchor primer (included in the 2nd Generation 5’/3’ RACE Kit, Roche) and GB3 (oligo 61 ...
-
bioRxiv - Genetics 2020Quote: ... These pieces were then added to the 3-4 ml of digestion media containing 0.1 mg/ml liberase (Roche, 501003280), 100 U/ml DNase I (Sigma ...
-
bioRxiv - Microbiology 2019Quote: ... Protein extracts were incubated for 3 h on a spinning wheel at 4°C with 40 µl of Protein G Sepharose beads (Roche) and 2.5 µg of the specific BTV-NS3 antibody ...
-
bioRxiv - Developmental Biology 2020Quote: ... They were then blocked in PBS with 3% BSA for 3h at RT and incubated overnight at 4°C with a peroxidase-labeled anti-DIG antibody (Roche) diluted 1:1500 in PBS with 3% BSA ...
-
bioRxiv - Cell Biology 2022Quote: ... Analysis was performed on either an LSRII 3 or 4-laser flow cytometer (Becton Dickinson) or Attune Acoustic Flow Cytometer (Roche). Post analysis was performed using either FACSDiva (BD) ...
-
bioRxiv - Cell Biology 2022Quote: ... The membrane was hybridized with a TAA(CCCTAA)4 probe which was conjugated with digoxigenin (DIG oligonucleotide 3⍰-end labelling kit, Roche) and signal was revealed using the anti-DIG-alkaline phosphatase antibodies (Roche ...
-
bioRxiv - Bioengineering 2023Quote: ... SOS1•RAS complex was formed by incubating SOS1 and RAS at a stochiometric ratio of 1:3 overnight at 4° with 20 mM EDTA and alkaline phosphatase (Roche). The complex was then purified by gel filtration ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 mM amino acids (Roche), 1 nM pY71sfGFP plasmid encoding superfolder GFP (M ...
-
bioRxiv - Neuroscience 2020Quote: ... with 0.34 mg/ml nitroblue tetrazolium (NBT) and 0.35 mg/ml 5-bromo-4-chloro-3indolyl-phosphate (BCIP; Roche), for 1–12 hours at room temperature with gentle agitation ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µl cDNA and 5 µl of LightCycler 480 SYBR Green I Master mix (Roche Diagnostics GmbH, Germany). Three technical replicates of each sample were included ...
-
bioRxiv - Physiology 2019Quote: ... for 45 seconds at 6,000 rpm x 3 (5 minutes on ice in between intervals) using a Roche Magnalyser instrument (Roche, Germany) and homogenization tubes containing ceramic beads (MagNA Lyser Green Beads ...
-
bioRxiv - Genomics 2020Quote: ... 60 μl of anti-mouse magnetic beads were washed PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche) or Anti-Rpb3 antibodies (Neoclone ...
-
Programmed ER fragmentation drives selective ER inheritance and degradation in budding yeast meiosisbioRxiv - Cell Biology 2021Quote: ... Pellets were resuspended by bead beating for 5 min in 100 μL TE supplemented with 3 mM and 1x protease inhibitors (Roche) with 100 μL acid-washed glass beads ...
-
bioRxiv - Cell Biology 2022Quote: Sense and anti-sense DIG-labelled RNA probes were synthesised from 5’ and 3’ regions of tert using DIG RNA Labelling Mix (Roche). A 562bp 3’ region of tert ...
-
bioRxiv - Neuroscience 2022Quote: Mounted coronal cryosections were rinsed in PBS for 3 times (5 min) and thereafter incubated in Blocking Reagent (Roche Diagnostics) for 15 minutes ...
-
bioRxiv - Genetics 2019Quote: ... located in exon 18 and reverse primer 5’-TTGGTGGCTACAAAGACGTG-3’ located in exon 22 using the One Tube reverse transcription-PCR reaction kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2019Quote: ... The central fragment of the molecule is flanked by oligonucleotides labelled either with digoxigenin (3’ end) or biotin (5’ end) that specifically bind either to a glass surface covered with Anti-digoxigenin (Roche) or to superparamagnetic beads (MyOne ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... ∼200-300 embryos were dechorionated 3-6 hours after injection by 5 min incubation in 1 mg/ml pronase (Roche) in E3 medium in a 2% agarose-coated petri dish and washed with excess amount of fresh E3 ...
-
bioRxiv - Biophysics 2021Quote: ... 10% w/v glycerol, 20 mM imidazole, 5 mM 2-mercaptoethanol, 1 mM PMSF, 3 U/mL benzonase, 1X Roche complete protease inhibitor without EDTA) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction was set by using qPCRBIO Probe Mix Hi-ROX (Nippongenetics) and TaqMan (5’: 6-FAM, 3’: TAMRA) or UPL (Universal Probe Library, Roche) probes ...
-
bioRxiv - Immunology 2023Quote: ... the common bile duct was clamped and the pancreatic duct was perfused with 3-5 mL solution of collagenase P in HBSS-1% HEPES (Roche). The pancreas was then harvested and transferred to a 50mL conical tube containing 5mL of collagenase P solution and kept on ice until all organs were collected ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting cDNAs were amplified with primers DP3 and DP5 (5’-GTTCAGAGTTCTACAGTCCGACGATC-3’, 0.5 μM) and KAPA Hifi HotStart DNA polymerase (Roche, KK2601) to the optimal amplification point ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 mM NaCl, 20 mM Imidazole pH 7.5, 3 mM MgCl2, 100 µM EDTA, 5 mM β-Mercapoethanol, 20 µM GDP, Roche cOmplete protease inhibitor cocktail and DNAse I ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 mM MgCl2, 0.5 mM β-mercaptoethanol, 1 mM ATP, 1% IGEPAL, 5% glycerol, 3 U/ml Benzonase and Roche Complete EDTA-free protease inhibitor ...
-
bioRxiv - Neuroscience 2024Quote: ... The sections were subsequently rinsed and incubated in the dark with a NBT/BCIP solution (Nitroblue tetrazolium chloride/ 5-bromo-4chloro-3-indyl-phosphate; Roche) until the staining appeared (overnight or up to 48 h) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Adapters were ligated by adding 15 µL of the ligation mix (3 µL T4 Ligase Buffer 10X, 0.5 µL T4 ligase (5 U/µL, Roche, 10799009001), 0.25 µl of x-Gene Stubby Adapter 50 mM (IDT) ...
-
bioRxiv - Cell Biology 2020Quote: Cell viability was determined by MTT (C, N-diphenyl-N′-4,5-dimethyl thiazol-2-yl tetrazolium bromide) assay (Roche, Switzerland), a standard colorimetric assay which uses the metabolic reduction of the tetrazolium salt to form the colored formazan product [33] ...
-
bioRxiv - Neuroscience 2020Quote: ... Supernatants from each buffer were dialyzed in 25 mM Tris-HCl and 5 mM EDTA pH 8.0 overnight at 4°C and subsequently digested with 200 mg/ml pronase (Roche). Peptides were precipitated with 5% trichloroacetic acid (TCA ...
-
bioRxiv - Molecular Biology 2020Quote: ... Membranes were blocked in 5% milk and probed overnight at 4°C with 1:2,500 rat anti-HA mAb 3F10 (Roche). They were then incubated for an hour at RT with 1:5,000 anti-rat horseradish peroxidase conjugated antibody (GE Healthcare) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The slides were washed and detection was performed at pH 9.5 by incubating in nitro blue tetrazolium and 5-bromo-4-cholro-2-indoyl phosphate solution (Roche) as per manufacturer instructions ...
-
bioRxiv - Immunology 2023Quote: ... fatty acid free (Roche, Basel, Switzerland), 50 μmol/L 2-mercaptoethanol (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... and 3-4 mice/group subcutaneously received 25ng/g of pegylated-human interferon α (Peg-hIFNα-2a) (Hoffmann La Roche, Basel, Switzerland). To activate IFN-1 signaling ...
-
bioRxiv - Biophysics 2019Quote: ... or for confocal in a alkaline-washed glass-bottomed chamber coated with human plasma fibronectin (25 µg/mL at 4°C overnight in 1/3 X MBS; Roche Molecular Biochemicals) in DFA supplemented with antibiotic/antimycotic (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cryosections were then washed 3 times for 5 minutes in PBT before being incubated with 1:10 TUNEL enzyme buffer (Roche #12156792910) at 37°C in the dark for 2 hours ...