Labshake search
Citations for Roche :
351 - 400 of 7469 citations for 7H Purine 7 acetamide N dibenzofuran 3 yl 1 2 3 6 tetrahydro 1 3 dimethyl 2 6 dioxo 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... using FuGENE 6 transfection reagent (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... either Fugene 6 (Roche Applied Science) or Transporter 5 transfection reagents were used ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 6 mg/ml dispase (Roche Applied Science ...
-
bioRxiv - Molecular Biology 2021Quote: ... lysate supernatant from cells expressing N-terminal 6-His-tagged proteins were incubated with nickel-nitrilotriacetic acid (Ni-NTA) cOmplete His-tag purification resin (Roche) for 1 h at 4° C ...
-
bioRxiv - Cell Biology 2022Quote: ... After three washes with PBS containing 0.5% Tween-20 samples were incubated with fluorescent labelled secondary antibodies containing 4′,6-diamidino-2-phenylindole (DAPI; Roche Cat# 10236276001, 1.0 µg/ml) for 30 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... 200 μM dNTPs (with 3:1 mix of 7-deaza-dGTP:dGTP; dNTPs from New England Bio Labs, cat#N0446, 7-deaza-2’-deoxy-GTP from Roche, cat#10988537001), 0.8 M Betaine (Alfa Aesar ...
-
bioRxiv - Physiology 2020Quote: ... Sigma Aldrich) with 3% bovine serum albumin (BSA, 735078, Roche Diagnostics GmbH, Mannheim, Germany), 20 µg/ml gentamicin (G1397 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and measured each at least 3 times (technical replicates) in the LightCycler96 (Roche, Germany). We detected expression using SYBRgreen marker (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Immunology 2022Quote: ... containing 3 mL of RPMI media with 70 μg / mL of Liberase TM (Roche) and 30 μg / mL of Dnase I (Roche) ...
-
bioRxiv - Immunology 2019Quote: Mouse lungs were homogenized in HEPES buffer with Liberase Blendzyme 3 (70ug/ml; Roche) and DNaseI (30ug/ml ...
-
bioRxiv - Biophysics 2020Quote: ... The oocytes were treated with collagenase A (3 mg/ml; Roche (Grenzach-Wyhlen, Germany)) for 105 min in Ca2+-free Barth’s solution containing (in mM ...
-
bioRxiv - Plant Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3’end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was completed with 3% BSA protease free (Roche Ref# 03 117 332 001) for 1 hour at RT ...
-
bioRxiv - Developmental Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). 10 picomols of each probe were used for each slide ...
-
bioRxiv - Immunology 2023Quote: ... minced with razor blade and digested enzymatically with 3 mg/mL collagenase/dispase (Roche) at 37 °C for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Physiology 2023Quote: ... and 0.165 mg/mL BCIP (5-Bromo-4-chloro-3-indolyl phosphate, Roche, 11383221001) in alkaline phosphatase buffer ...
-
bioRxiv - Genetics 2023Quote: ... Bound protein/protein complexes were washed 3 times ((1x TBS, 0.5% Nonident P40 (Roche), 1% phosphatase inhibitor cocktail 2 and 3 (Sigma)) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Immunology 2023Quote: ... containing 3 mL of RPMI media with 70 µg / mL of Liberase TM (Roche) and 30 µg / mL of DNase I (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... the cell samples were incubated with 300 nM DAPI (Cat# 28718-90-3, Roche) in PBS for 15 min and washed three times with PBS ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 400nM 5-Bromo-4-chloro-3-indolyl phosphate p-toluidine salt (BCIP, Roche).
-
bioRxiv - Microbiology 2024Quote: ... and specific primers (Table 3) on the LightCycler 480 Real-Time PCR System (Roche). Fold change was calculated using the comparative 2-ΔΔCt method ...
-
bioRxiv - Microbiology 2022Quote: ... Two µg plasmid DNA and 25 µL DOTAP (N-[1-(2,3- Dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate) (Roche Diagnostics Deutschland GmbH ...
-
bioRxiv - Microbiology 2022Quote: Fresh pre-cut pancreatic tissue (2 × 2 mm) were digested with a solution of collagenase P in HBSS-1% HEPES (0.75 mg/mL, Roche) at 37°C for 7 min with shaking ...
-
bioRxiv - Plant Biology 2023Quote: ... in 100μl extraction buffer (Tris-HCl 50 mM pH 6.8, SDS 2%, DTT 2 mM and 1× protease inhibitors (Roche) and centrifuged for 5 min at 13,000g at 4OC ...
-
bioRxiv - Cancer Biology 2022Quote: ... and glands minced with surgical scissors before enzymatical dissociation for 1.5h in DMEM/F12 (1:1) supplemented with 2 mg mL−1 collagenase (Roche) + Gentamicin (Gibco) ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.1% (v/v) 2-mercaptoethanol and 1× protease inhibitors (Roche; 11836170001). Insoluble material was removed by centrifuging at >12,000 × g for 10 min at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... or with 1:10 Dnase I (stock 2 U/μL, Roche), and micrococcal nuclease (stock 2000 U/μL ...
-
bioRxiv - Immunology 2022Quote: ... 2 ml of DMEM with 0.26 U ml−1 LiberaseTM (Roche) and 0.25 mg ml−1 DNase I (Roche ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 μg ml-1 pepstatin and protease inhibitor cocktail tablets (Roche). The cells were then lysed by sonication and cell debris was removed by centrifugation at 30,000 g for 45 min at 4° C ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 μg ml-1 pepstatin and protease inhibitor cocktail tablets (Roche) and lysed with an EmulsiFlex-C3 homogenizer at pressures above 20,000 psi ...
-
bioRxiv - Molecular Biology 2019Quote: pLKO.1 lentiviral construct along with packaging vector ΔVPR and VSVG plasmids were transfected using Fugene-6 (Roche) or PEI (POLYSCIENCES 23966-2 ...
-
bioRxiv - Microbiology 2023Quote: ... 2 % N-lauroylsarcosine (w/v)) supplemented with Protease Inhibitors Cocktail (cOmplete ULTRA Tablets, Roche), DNaseI (1 µg/ml ...
-
bioRxiv - Molecular Biology 2020Quote: ... Blocking of membranes was carried out in buffer 2 (buffer 1 plus 1% blocking reagent (Roche)) for 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... pellets were resuspended in 100 µL of lysis buffer (50 mM Tris pH 7.5, 1 mM EDTA, 3 mM DTT, 1X cOmplete protease inhibitor cocktail [SKU, 11836145001, Roche], 1.1 mM PMSF, and 1X Pepstatin A) and beaten on a bead-beater for 5 minutes at room temperature with 100 µL of acid-washed glass beads (cat ...
-
bioRxiv - Cancer Biology 2023Quote: ... CD8 (clone SP57 at 1:7, Ventana- Roche), PD-1 (clone NAT105 ...
-
bioRxiv - Immunology 2024Quote: ... Sera were analysed for antibody directed against the SARS-CoV-2 Spike protein receptor-binding domain (S-RBD) and nucleocapsid (N) using an established automated electrochemiluminescence assay (Elecsys Anti-SARS-CoV-2 S and N, Roche diagnostics) [54] ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 0.18 μL Fugene 6 reagent (Roche, Basel) was added to 4.82 μL serum free medium and incubated for 5 min at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... using random primers p(dN)6 (Roche). Quantitative PCR reactions were performed in a BioRad CFX96 system employing the SYBRgreen fluorescent reagent (Applied Biosystems ...
-
bioRxiv - Neuroscience 2020Quote: ... using FuGENE® 6 (Roche, Basel, Switzerland), using standard procedures ...
-
bioRxiv - Neuroscience 2020Quote: ... using random primers p(dN)6 (Roche). Quantitative PCR reactions were performed using standard protocols using EvaGreenTM in the Stratagene Mx3000P system (Agilent Technologies) ...
-
bioRxiv - Cancer Biology 2023Quote: ... the RNase A (6 µg/mL, Roche) was added or not directly to the reaction mixture ...
-
bioRxiv - Microbiology 2023Quote: ... using random primers p(dN)6 (Roche). Quantitative real-time PCR was performed on a real-time PCR system (Quant Studio 6 Flex ...
-
bioRxiv - Cell Biology 2024Quote: ... using random primers p(dN)6 (Roche). Quantitative real-time PCR reactions employing SYBRgreen fluorescent reagent and/or EvaGreen™ were performed in the Stratagene Mx3000P system (Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... monocytes were harvested using ice-cold lysis buffer (1% Triton X-100, 2% SDS, 150 mM NaCl, 10 mM HEPES, 2 mM EDTA containing protease inhibitor cocktail - Roche). Cell lysates were heated at 100 °C for 5 min in the presence of Laemmli buffer (20% β-mercaptoethanol ...