Labshake search
Citations for Roche :
51 - 100 of 8935 citations for 7H 1 2 3 Triazolo 4 5 d pyrimidin 7 one 3 6 dihydro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... 10% w/v glycerol, 20 mM imidazole, 5 mM 2-mercaptoethanol, 1 mM PMSF, 3 U/mL benzonase, 1X Roche complete protease inhibitor without EDTA) ...
-
bioRxiv - Zoology 2023Quote: ... Single staining was performed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP; 1:50 dilution in alkaline buffer; Roche Diagnostics). The cells were then stained overnight at room temperature.
-
bioRxiv - Biochemistry 2022Quote: ... followed by collagenase D (3 mg/mL, COLLD-RO, Roche) two times at 37 degrees ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Genetics 2019Quote: ... located in exon 18 and reverse primer 5’-TTGGTGGCTACAAAGACGTG-3’ located in exon 22 using the One Tube reverse transcription-PCR reaction kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and the alkaline phosphatase substrate 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and 4-nitroblue tetrazolium chloride (NBT) (Roche Diagnostics). After washing ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...
-
bioRxiv - Biophysics 2021Quote: ... 3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate (CHAPS, Roche Life Sciences, Indianapolis, IN) micelles and also using 1,2-dihexanoyl-sn-glycero-3-phosphocholine (DHPC)/1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC ...
-
bioRxiv - Developmental Biology 2024Quote: ... cells were stained with 4′,6-diamidino-2-phenylindole (DAPI) (Roche, 10236276001; 1:10,000) for 5 minutes ...
-
bioRxiv - Biophysics 2021Quote: ... 0.1% (v/v) 2-mercaptoethanol and 60 × 10−3 М n-Octyl-β-D-Glucopyranoside) containing protease inhibitor (Roche). Total protein was collected and incubated with anti-p75NTR (Alomone ...
-
bioRxiv - Neuroscience 2019Quote: ... BCIP (5-Bromo-4-chloro-3-indolyl-phosphate, 4-toluidene salt, Roche, Cat. No. 11 383 221 001. 105 µl/40 ml) and Levamisole (Vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction was set by using qPCRBIO Probe Mix Hi-ROX (Nippongenetics) and TaqMan (5’: 6-FAM, 3’: TAMRA) or UPL (Universal Probe Library, Roche) probes ...
-
bioRxiv - Microbiology 2021Quote: ... employing 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) and nitro blue tetrazolium (NBT) as substrates (RocheR, Roche Applied Sciences ...
-
bioRxiv - Neuroscience 2020Quote: ... the alkaline phosphatase activity was detected by using nitroblue tetrazolium chloride (337.5μg/ml) and 5-bromo-4-chloro-3-indolyl phosphate (175μg/ml) (Roche Diagnostics). Sections were mounted in Mowiol.
-
bioRxiv - Developmental Biology 2019Quote: ... and stained with standard Nitro Blue Tetrazolium (NBT) and 5-Bromo-4-chloro-3-indolyl phosphate (BCIP) (Roche) ISH protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Colorimetric signals were generated using a development solution containing 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Genetics 2022Quote: ... sections were incubated with DAPI (4′,6-diamidino-2-phenylindole dihydrochloride, Roche, 1:250 dilution) for 10 sec and washed in PBS.
-
bioRxiv - Developmental Biology 2024Quote: ... Cell nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, 1 μg/mL, Roche). To reduce autofluorescence ...
-
bioRxiv - Cell Biology 2020Quote: ... The cartilage was then incubated in 3 mg/mL Collagenase D (Roche) in DMEM solution for two 45 minute periods and transferred to 0.5 mg/mL Collagenase D in DMEM solution supplemented with 3% Liberase TL (Sigma ...
-
bioRxiv - Molecular Biology 2020Quote: ... and then with DAPI (4′,6-Diamidino-2-phenylindole, Roche) for 15 min ...
-
bioRxiv - Neuroscience 2022Quote: ... and then reacted with 0.375 mg/mL nitroblue tetrazolium and 0.188 mg/mL 5-bromo-4-chloro-3-indolylphosphate (NBT/BCIP; Roche Diagnostics) for 27—42 h.
-
bioRxiv - Plant Biology 2021Quote: ... in paraffin-embedded sections (8µm) and color was detected with 5-bromo-4-chloroindol-3-yl phosphate/nitrateblue tetrazolium (BCIP/NBT) (Roche).
-
bioRxiv - Immunology 2019Quote: ... for 3 h followed by 5 mM ATP (10519987001, Roche) or 20 μM nigericin (N-7143 ...
-
bioRxiv - Immunology 2020Quote: ... for 3 h followed by 5 mM ATP (10519987001, Roche) for 45 min were used as positive controls for caspase-1 and IL-1β blots ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-CAGACACGCAGACTCTTTC-3’) and 2.5 µl reverse primer (10 µM; 5’-CTAAAGATGTGTGTCTTCCTCA-3’) using the Expand Long Template PCR System (Roche). The PCR conditions were 35 cycles at 95°C for 30 sec ...
-
bioRxiv - Cell Biology 2022Quote: ... all sections were stained with DAPI (4′,6-Diamidine-2′-phenylindole dihydrochloride, #10236276001, Roche, 1:3000) to visualize cell nuclei within the aortic tissue ...
-
bioRxiv - Microbiology 2020Quote: ... and BCIP (1,5-bromo-4-chlooro-3-indolyl-phosphate, Roche, Switzerland).
-
bioRxiv - Biochemistry 2021Quote: ... 5mM CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate) and 1 tablet of Protease Inhibitor Cocktail (ROCHE, cOmplete™). The preparation was sonicated for 120 s on ice ...
-
bioRxiv - Developmental Biology 2021Quote: ... Gene expression signals were visualized using nitroblue tetrazolium/5-bromo-4-chloro-3-indolylphosphate solutions using a standard method (Roche). Whole-mount and sectioned specimens of Ciona were observed using an SZX12 stereo microscope (Olympus ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by visualization with nitro blue tetrazolium and 5-bromo-4-chloro-3-indolylphosphate (NBT/BCIP) (Roche Diagnostics, Basel, Switzerland). Embryos were imaged using a Leica M205 FA epifluorescence microscope (Leica ...
-
bioRxiv - Developmental Biology 2020Quote: ... The embryos were subsequently incubated in the dark on a slow rocker in dilutions of Nitro-blue tetrazolium/5-bromo-4-chloro-3-inodyl phosphate (NBT/BCIP; Roche) in TBST ...
-
bioRxiv - Neuroscience 2020Quote: ... Detection of DIG-probes was made in staining buffer (in 10% polyvinyl alcohol) supplemented with nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate (BCIP) (Roche). In addition ...
-
bioRxiv - Genetics 2022Quote: ... Expression patterns were visualized with a Nitro-Blue Tetrazolium Chloride/5-Bromo-4-Chloro-3-Indolyphosphate p-Toluidine Salt (NBT/BCIP) system (Roche). Sections were mounted with Vectamount (Vector laboratories ...
-
bioRxiv - Developmental Biology 2019Quote: ... and then incubated at room temperature in the same solution containing NBT-BCIP (nitrotetrazolium blue chloride at 350 µg/ml and 5-bromo-4-chloro-3-indolyl phosphate p-toluidine salt at 175 µg/ml) (Roche) until the color appeared ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1% Tween 20 in water) and incubated in NBT/BCIP (nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate) solution (Roche).
-
bioRxiv - Cell Biology 2021Quote: ... Cardiac tissue sections were either stained for 5-bromo-4-chloro-3-indolyl-b-galactosidase (Xgal; Roche Cat #XGAL-RO) or immunostained with rabbit anti-mouse polyclonal Ror2 (provided by Dr ...
-
bioRxiv - Microbiology 2022Quote: ... The membrane was washed again with 1x TBST 3-5 times for a total of 20 min and developed using 5-bromo-4-chloro-3-indolylphosphate (BCIP)/ nitro-blue tetrazolium (NBT) (Roche) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Hybridised probes were detected with anti-DIG antibodies and revealed with alkaline phosphatase-conjugated antibodies in presence of nitro blue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl phosphate (BCIP, Roche).
-
bioRxiv - Neuroscience 2022Quote: ... Alkaline phosphate labeling was detected by incubation overnight at room temperature in the dark with a nitroblue tetrazolium plus 5-bromo-4-chloro-3 indolyl-phosphate mixture (Roche) with levamisole (Sigma) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.1% Tween 20 in water) and incubated in NBT/BCIP (nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate) solution (Roche).
-
bioRxiv - Neuroscience 2023Quote: ... slides were incubated at 37oC in a staining solution containing nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate (Roche) for 20-24 hours ...
-
bioRxiv - Pathology 2023Quote: ... Bound alkaline phosphatase was visualized with nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl-phosphate (NBT/BCIP; 11681451001, Roche). The reaction was stopped by incubation in buffer 4 (10 mM Tris and 1 mM EDTA ...
-
bioRxiv - Immunology 2022Quote: ... nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI) (Roche) for 4 min at room temperature and observed them under a Laserscaing Confocal Microscopy (TCS SP8 STED ...
-
bioRxiv - Cell Biology 2023Quote: ... or 1µg/mL 4’,6’-diamidine-2’-phenylindole dihydrochloride (DAPI) (Roche).
-
bioRxiv - Immunology 2023Quote: ... samples were counterstained with 4’,6-Diamidino-2-phenylindol (DAPI, Roche).
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Embryos were then washed with wash buffer and their nuclei stained with 5 ug/mL DAPI (4′,6-diamidino-2-phenylindole, Roche) prepared in wash buffer for 10 minutes at 30 ºC.