Labshake search
Citations for Roche :
151 - 200 of 3519 citations for 7 TRIFLUOROMETHYL 2 3 4 5 TETRAHYDRO 1H BENZO B AZEPINE HYDROCHLORIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... The 5’ and 3’ linkers were terminally labelled with digoxigenin-11-dUTP (Roche) or biotin-16-dUTP (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... based on the 5′ and 3′ RACE kit (2nd generation, Roche, Basel, Switzerland). Viral nucleic acids were extracted from 140 μl of the virus transport medium derived from the nasopharyngeal swab using the viral RNA isolation kit according to the manufacturer’s protocol (Qiagen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... After 3 minutes 10 μL of 5 mg/mL Liberase (Roche, cat # 05401119001) were added ...
-
bioRxiv - Physiology 2020Quote: ... containing 0.2 mg 4-(2-aminoethyl)-benzene-sulfonyl fluoride (AEBSF, Roche). Serum from blood samples was obtained by centrifugation at 3,000 rpm for 15 min ...
-
bioRxiv - Immunology 2022Quote: ... nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI) (Roche) for 4 min at room temperature and observed them under a Laserscaing Confocal Microscopy (TCS SP8 STED ...
-
bioRxiv - Cell Biology 2023Quote: ... or 1µg/mL 4’,6’-diamidine-2’-phenylindole dihydrochloride (DAPI) (Roche).
-
bioRxiv - Immunology 2023Quote: ... samples were counterstained with 4’,6-Diamidino-2-phenylindol (DAPI, Roche).
-
bioRxiv - Cancer Biology 2022Quote: ... B cells were thawed in B cell medium containing DNAse (Pulmozyme, Roche) 20 h before use in co-culture assays ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 5 mM MgCl2) containing 4-nitro blue tetrazolium chloride (NBT, Roche), 5-bromo-4-chloro-3-indolyl-phosphate (BCIP ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the gRNA_enrichment1_fw (5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTGTG-GAAAGGACGAAACACCG-3’) and gRNA_enrichment1_rv (5’-CTACACGAC-GCTCTTCCGATCT-3’) primers and the 2x KAPA HiFi HotStart Ready Mix (Roche, Cat. No. KK2601). In a subsequent PCR ...
-
bioRxiv - Neuroscience 2024Quote: ... 5’-ATGGGCACCCAAAACAACAGT-3’ and 5’-GCGGCAGCACATATCCAAAAA-3’) was PCR amplified with a fast-cycling polymerase (KAPA2G Fast HotStart PCR kit, KAPA Biosystems) and a subsequent gel-electrophoresis ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 mM b-mercaptoethanol (BME)] in the presence of an anti-protease cocktail (Complete EDTA-free, Roche) and 1 μl of benzonase (Merck Millipore ...
-
bioRxiv - Molecular Biology 2023Quote: ... Hearts were cut into 1–2 mm3 pieces and incubated with 0.5 U/mL collagenase B (Roche #11088807001) in 0.2% NaN3/PBS and left to oscillate at 1000 rpm at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... Collagenase B (0.2%) (Roche) and MgCl2 (5 mM ...
-
bioRxiv - Molecular Biology 2020Quote: ... Then cells were lysed in B-per protein extraction reagent 4 ml/ gram bacterial pellet in the presence of cOMPLETE mini protease inhibitor cocktail (Roche) for 15 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... digested rotating for 1h at 37°C with 2mg/ml Collagenase/Dispase (Roche) and then filtered twice (100 μm ...
-
bioRxiv - Biophysics 2023Quote: ... the lysate was incubated for 1h with cOmplete His-Tag Purification Resin (Roche) at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... the DNA template was degraded by 1h incubation with 0.2U/µL DNaseI (Roche). Transcription products were loaded on a 1 mL G-25 Superfine Sephadex column (Cytiva ...
-
bioRxiv - Biochemistry 2022Quote: ... or octamer-mix were done at 900 MHz 1H Larmor frequency at 298 K in NMR buffer (25 mM NaPi, pH 7, 5% D2O, with 1x protease inhibitors (complete EDTA-free cocktail, Roche)) with 600 mM NaCl for the titrations with H2A-H2B and H3-H4 and 300 mM NaCl for titration with octamer-mix ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were lysed by sonication and French Press in purification buffer (50mM sodium phosphate buffer pH 7, 300 mM NaCl) supplemented with 5 ug/mL DNaseI (Roche), 5ug/mL RNAse (Sigma-Aldrich) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 2) 5 10^6 copies of bacteriophage MS2 RNA (Roche) were spiked in per isolation ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20 μl of 10X 5-Bromo-2’-deoxyuridine (BrdU) (Roche, Germany) per well was added ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were counterstained with 4’,6-Diamidine-2’-phenylindole-dihydrochloride (DAPI; Roche).
-
bioRxiv - Molecular Biology 2023Quote: ... nuclei were stained using 4’,6-diamidino-2-phenylindole (DAPI, Roche Diagnostics) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... Monoclonal (3F10) antibody directed against the HA epitope and monoclonal (B-2) antibody against GFP were purchased from Roche and Santa Cruz Biotechnology (Dallas ...
-
bioRxiv - Neuroscience 2024Quote: ... and BCIP (5-bromo-4-chloro-30-indoly phosphate p-toluidine salt, Roche). After development ...
-
bioRxiv - Cell Biology 2019Quote: Zebrafish samples for Western blot analysis were deyolked and directly lysed in 2x Laemmli Sample Buffer containing 5% b-ME and a PhosSTOP tablet (Roche), 10 ul per embryo unless otherwise indicated ...
-
bioRxiv - Cell Biology 2019Quote: ... HUVEC cells for Western blot analysis were lysed directly in 2x Laemmli Sample Buffer containing 5% b-ME and a PhosSTOP tablet (Roche), 500ul per T-25 culture flask.
-
bioRxiv - Cell Biology 2020Quote: ... anti-SPD-5 (1:1000, a generous gift from B. Bowerman, Hamill et al., 2002) and anti-GFP (1:500, Roche) overnight at 4°C and with secondary antibodies Alexa488 (1:500 ...
-
bioRxiv - Neuroscience 2019Quote: ... Tongues were removed and injected beneath the lingual epithelium with 0.2 mL enzyme solution (3 mg Dispase II, 0.7 mg collagenase B (Roche diagnostics, Indianapolis, IN, USA) and 1 mg Trypsin Inhibitor in 1mL Tyrode’s) ...
-
bioRxiv - Biophysics 2022Quote: ... embryos were washed (4 X 10 min) in PBTx and blocked in PBT-B (1× PBS, 20% (v/v) western blocking reagent (Roche, 11921673001), 2 mM ribonucleoside vanadyl complex (NEB ...
-
bioRxiv - Microbiology 2023Quote: Transcriptional start sites (TSS) of rokL6 and sco1448 were determined by 5’ RACE using a 5’/3’ RACE Kit 2nd generation (Roche, California, US). Total RNA (2 μg ...
-
bioRxiv - Microbiology 2021Quote: ... The cell lysate was prepared by sonication of 2×108 cells on ice in 100 mM sodium phosphate buffer pH 7 including EDTA-free Complete Protease Inhibitors (Roche) and 0.01% TX-100 ...
-
bioRxiv - Neuroscience 2022Quote: ... Cell pellets were homogenized in lysis buffer (7 M urea, 2 M thiourea, 1% CHAPS, 70 mM DTT, and Roche EDTA-free complete protease inhibitor cocktail ...
-
bioRxiv - Plant Biology 2023Quote: Proteasome activity was measured by spectrofluorometry using the 7-amino-4-methylcoumarin (AMC)-labeled fluorogenic substrate succinate-LLVY-AMC (Roche Sigma-Aldrich) in cleared extracts of leaf 1 at different dpg (Üstün and Börnke ...
-
bioRxiv - Bioengineering 2023Quote: ... dissociated at 37°C for 1h in collagenase (0.5 mg/mL, Roche Life Sciences) / DNase (0.19 mg/mL ...
-
bioRxiv - Plant Biology 2023Quote: ... Membrane was pre-hybridized 1h at 50°C in a DIG eazy Hyb (Roche) and then hybridized overnight at 50°C in same buffer using a denatured probe ...
-
bioRxiv - Neuroscience 2020Quote: ... Peels were cut in 2-5 mm2 pieces and placed in 5 ml digestion solution (0.75 mg/ml Liberase TH Research grade (Roche), 0.1 mg/ml DNAseI (Sigma-Aldrich ...
-
bioRxiv - Immunology 2019Quote: ... memory B cells were plated at 6 B cells in 55 μl per well into 96 × 384-well plates in B cell media supplemented with 100 U ml−1 IL-2 (Roche), 50 ng ml−1 IL-21 (Invitrogen) ...
-
bioRxiv - Cell Biology 2023Quote: ... The cell pellet was resuspended and homogenized in buffer B supplemented with 2 mM MgCl2 and 1x protease inhibitor (Roche). The protein was extracted by incubating with 1% GDN (Anatrace ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... lumbar vertebrae 1 – 5 were incubated in 2% Collagenase P (Roche, Switzerland) for 30 minutes at 30° C ...
-
bioRxiv - Neuroscience 2020Quote: ... Then embryos were incubated for 2 hours in 5% Blocking Reagent (Roche) in MAB (150 mM maleic acid ...
-
bioRxiv - Genomics 2023Quote: ... 5 mM 2-mercaptoethanol and cOmplete Protease Inhibitor Cocktail (Roche, no. 11697498001). The cell suspension was subjected to sonication (Qsonica ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 % SDS and 5 mM EDTA) supplemented with 1x complete protease inhibitor cocktail (Roche, Switzerland) and 1 mM phenylmethylsulfonyl fluoride ...
-
bioRxiv - Cell Biology 2020Quote: ... as well as AP substrate consisting of 5-bromo-3-chloro-indolyl phosphate (Roche Diagnostics) and 4-nitro blue tetrazolium chloride (Roche Diagnostics ...
-
bioRxiv - Molecular Biology 2022Quote: To determine the repM transcription start site a 2nd Generation 5’/3’ RACE Kit (Roche) was used according to the manufacturer’s instructions with some modifications ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primer2: 5’-CAAGCAGAAGACGGCATACGA*G-3’) and 15µl 2x Kapa HiFi HotStart Ready Mix (Kapa Biosystems), amplification was performed for 45 s at 98°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... were stained overnight with 4′,6-diamidino-2-phenylindole (DAPI, Roche, Basel, Switzerland) at a final concentration of 5 µg ml-1 ...