Labshake search
Citations for Roche :
351 - 400 of 2675 citations for 7 S 17 S dihydroxy 8 E 10 Z 13 Z 15 E 19 Z Docosapentaenoic Acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... 5 mM CaCl2 and 15 units of S7 micrococcal nuclease (Roche). Lysates were sonicated for 10 seconds at low power followed by incubation on ice for 30 minutes and clarification by centrifugation at 13,000 x g for 15 minutes at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... The bacteria were stained with 15 μg/mL of DAPI (Roche) for 30 min at room temperature and imaged using a 63× oil immersion lens on a Zeiss Axio Imager.M2 microscope.
-
bioRxiv - Molecular Biology 2019Quote: ... 13 µL of 1:25 diluted cDNA was added to 16.25 µL KAPA 2x SYBR Fast Master Mix (KAPA Biosystems, Wilmington, MA) and 3.25 µL primer sets (Table 2.3 ...
-
bioRxiv - Genomics 2020Quote: ... Muscles were digested with 8 mg/ml Collagenase D (Roche, Basel, Switzerland) and 10 U/ml Dispase II (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: ... which had been pre-treated with 8 μg/ml mitomycin C (Roche). Throughout the immortalization process ...
-
An optimized ChIP-Seq framework for profiling of histone modifications in Chromochloris zofingiensisbioRxiv - Genomics 2021Quote: ... The ligated products were enriched with 8 cycles of PCR (KAPA biosystems) and size selected to 200-500 bp with Total Pure NGS beads (Omega Bio-tek) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 8 M Urea loading dye was supplemented with complete protease inhibitor (Roche). 100 μl Urea loading dye were used to resuspend cell pellet after NaOH treatment ...
-
bioRxiv - Molecular Biology 2021Quote: ... which had been pre-treated with 8 μg/ml mitomycin C (Roche). Throughout the immortalization process ...
-
bioRxiv - Systems Biology 2023Quote: ... Muscles were digested with 8 mg/ml Collagenase D (Roche, Basel, Switzerland) and 10 U/ml Dispase II (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 mM Tris pH 8 in water) with Protease inhibitors (Roche, 11836170001). WCL lysate was incubated on ice for 30 min and centrifuged at max speed for 10 min to remove debris ...
-
bioRxiv - Cancer Biology 2023Quote: ... 50mM Tris-HCl (pH 8) + protease inhibitor cocktail (PIC, cOmplete Mini, Roche)] and sonicated under optimized conditions that yielded an average DNA length of ∼300 bp ...
-
bioRxiv - Molecular Biology 2023Quote: ... pH 8) supplemented with cOmplete™ EDTA-free protease inhibitor tablets (Roche) and Benzonase® nuclease ...
-
Dysregulated expanded endocannabinoid system as therapeutic targets of amyotrophic lateral sclerosisbioRxiv - Neuroscience 2024Quote: Cell viability assays were performed using a WST-8 kit (Roche Diagnostics) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... 8 M Urea and 1x cOmpleteTM EDTA-free protease inhibitor (Roche #11873580001). Lysates were sonicated with a probe sonicator and cleared via centrifugation at 15,000x g for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... and 5 µg of a WEAU gp160 plasmid (pcDNA3.1-WEAU gp160) into exponentially dividing 293T/17 cells using FuGENE 6 (Roche Applied Science, Indianapolis, IN) or into 293F cells using 293fectin (Invitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... Reverse transcription was performed adding 2 μl of DNAse-treated RNA to 17 μl reaction mixture containing 1X Expand Reverse Transcriptase Buffer (Roche Diagnostics, Mannheim, Germany), 10mM of Dithiothreitol (DTT ...
-
bioRxiv - Genetics 2022Quote: ... q-PCR was carried out using the PCR Biosystems Sygreen Blue Mix Separat -ROX (Cat. No. 17-507DB) in a LightCycler 480 Real-Time PCR system (Roche Diagnostics Corp., IN). Quantification was performed using the comparative ΔΔCt method and normalization for internal reference was done using either act-5 or pmp-2 ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Immunology 2023Quote: ... a left lobe was digested for 1 hour at 37°C in RPMI containing 13 mg/mL DNase I (Roche, Randburg, South Africa) and 50 U/mL collagenase IV (Gibco ...
-
bioRxiv - Microbiology 2024Quote: ... The fragmented samples were purified and concentrated to a volume of 13 µl using the SPRI method (Solid Phase Reversible Immobilization) with Kapa Pure Beads (Roche, cat. no. 07983298001). Elution was performed for 10 minutes at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... 15 min at 1900 rcf) or according to the manufacturers’ guidelines (Roche, 10 min at 1600 rcf and Biomatrica ...
-
bioRxiv - Microbiology 2021Quote: ... 15 mM Imidazole) containing one complete EDTA-free protease inhibitor tablet (Roche), 0.1 mg/ml lysozyme ...
-
bioRxiv - Cell Biology 2022Quote: ... and amplified for 15 cycles using KAPA HiFi PCR Kit (KAPA biosystems). cDNA was then separated into two fractions by size using 0.5X and 1X AMPure PB Beads (Pacific Scientific) ...
-
bioRxiv - Genetics 2023Quote: ... and amplified for 15 cycles using KAPA HiFi HotStart ReadyMix (KAPA BIOSYSTEMS). Following a final purification with Agencourt AMPure XP beads ...
-
bioRxiv - Genetics 2024Quote: ... and 15 μL of Kapa HiFi HotStart ReadyMix polymerase (Roche Diagnostics, KK2601). Each reaction tube was initially incubated at 95°C for 5 mins ...
-
bioRxiv - Developmental Biology 2020Quote: ... The embryos were blocked in Blocking Buffer + Maleic Acid (Roche, 11585762001) for at least 3 hours before the anti-DIG antibody was added in a concentration of 1:5000 and incubated overnight at 4°C ...
-
bioRxiv - Biochemistry 2020Quote: ... followed by optional sialic acid removal using 0.02 U sialidase (Roche), prior to in-gel trypsin treatment49 ...
-
bioRxiv - Plant Biology 2020Quote: ... Digoxigenin was detected using DIG Nucleic Acid Detection Kit (Roche, USA).
-
bioRxiv - Systems Biology 2021Quote: ... 2% fatty acid-free bovine serum albumin (BSA) fraction V (Roche), 50 μmol/L 2-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2022Quote: ... 0,002% mellitic acid and 1 pastil of protease inhibitors cocktail (Roche)).
-
bioRxiv - Neuroscience 2021Quote: ... 25 nM okadaic acid and a protease inhibitor cocktail tablet (Roche). Soluble and insoluble fractions of total homogenates were obtained as previously described (30) ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 x Protease Inhibitor cocktail ethylenediaminetetraacetic acid (EDTA)-free (PI, Roche), 10 mM NaF (Nacalai tesque) ...
-
bioRxiv - Biophysics 2022Quote: ... 1 tablet ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor (Roche diagnostics, GmbH), pH 8) ...
-
bioRxiv - Neuroscience 2023Quote: ... and ethylenediaminetetraacetic acid-free Complete Protease Inhibitor Cocktail (Roche Applied Science). After centrifugation at 20,000[×[g for 30 min at 4 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 tablet crushed complete EDTA (ethylenediaminetetraacetic acid)-free protease inhibitor (Roche), 0.5 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Cancer Biology 2020Quote: ... cell lysates were prepared as described previously [17] Quantitative detection of mRNA was performed by real-time PCR using the Lightcycler 480 detector (Roche Applied Science, Manheim Germany) as previously published [17].
-
bioRxiv - Neuroscience 2020Quote: ... 1 mM EDTA pH 8) in presence of Complete Protease Inhibitor Cocktail (Roche) and Halt Phosphatase Inhibitor Cocktail (Pierce) ...
-
bioRxiv - Biochemistry 2021Quote: ... pH 8) containing one tablet of cOmplete EDTA-free Protease Inhibitor Cocktail (Roche). Cells were lysed via two passages through a French pressure cell at 1,500 psi ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the remaining 21865 reads (∼8 Mb) were submitted for assembly by Newbler (Roche). Of the 6309 obtained contigs (N50 = 663 bp) ...
-
bioRxiv - Microbiology 2021Quote: ... pH 8 (buffer A) supplemented with EDTA free complete protease inhibitor tablets (Roche). The cells were lysed using a French press at 18000 psi ...
-
bioRxiv - Cell Biology 2022Quote: Conjugation of protein or nanobody was performed with an 8-fold (Laminin; Roche) or 4-fold (R2-myc-his ...
-
bioRxiv - Genetics 2023Quote: ... with 6-8 cycles of PCR amplification using KAPA-HiFi (Kapa Biosystems, KK2602). DNA library was sequenced using an Illumina NextSeq 500 75-cycle high output kit.
-
bioRxiv - Cell Biology 2021Quote: ... 20 mM Tris-HCl (pH 7) and EDTA-free protease inhibitor cocktail (cOmplete™, Roche # 11873580001). After 30 min incubation on ice ...
-
bioRxiv - Genomics 2020Quote: ... 0.1% IGEPAL CA-630)7 supplemented with protease inhibitors (Complete Protease Inhibitor Cocktail, EDTA-free, Roche). Embryos were homogenized in a Dounce homogenizer then incubated in cold lysis buffer at 4°C for 1 hour ...
-
bioRxiv - Genetics 2021Quote: ... Two corneas (per mouse) were incubated in 15 mg/ml Dispase (4942078001, Roche) in DMEM (Gibco ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were blocked for 15 minutes in Blocking Reagent (Roche Diagnostics, room-temperature) and subsequently incubated with primary antibodies anti-Nur77 (NR4A1 ...
-
bioRxiv - Neuroscience 2023Quote: ... mechanically dissociated and digested for 15 minutes with liberase (0.4 U/mL; Roche) and DNAse I (120 U/mL ...
-
bioRxiv - Developmental Biology 2023Quote: ... 15 mM MgCl2) in the presence of Protease Inhibitor Cocktail (PIC; 5056489001, Roche). Nuclei were pelleted and lysed for 1 h at 4 °C (300 mM NaCl ...
-
bioRxiv - Cell Biology 2023Quote: ... The whole transcriptome was amplified (15 cycles) by KAPA HiFi DNA polymerase (Roche), and then size-selected using 0.6X AmpPure XP beads (Beckman Coulter) ...
-
bioRxiv - Plant Biology 2024Quote: ... then 15 μl of 20 mg/ml Proteinase K (Roche #46950800/Sigma #3115887001) per sample was added and the tissue was ground again ...