Labshake search
Citations for Roche :
51 - 100 of 1676 citations for 7 MethoxybenzoFuran 2 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... Fatty acid free (FAF) BSA was from Roche Diagnostics ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.5% deoxycholic acid) with protease inhibitor mixture (Roche) and clarified by centrifugation at high speed (20,000 rcf) ...
-
bioRxiv - Physiology 2021Quote: ... 0,5% deoxycholic acid and protease inhibitors (11697498001, Roche). Cells were then scrapped ...
-
bioRxiv - Microbiology 2021Quote: ... and ADNaCl with fatty-acid-free BSA (Roche). Modified Sauton’s solid medium contained 1.5% bactoagar (BD ...
-
bioRxiv - Microbiology 2023Quote: ... and ADNaCl with fatty-acid-free BSA (Roche). For modified Sauton’s solid medium ...
-
bioRxiv - Microbiology 2023Quote: ... 0.4% blocking reagent for nucleic acids (Roche, Switzerland)) ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.1% deoxycholic acid with protease inhibitors (Roche). The lysates were subjected to anti-GFP immunoprecipitation using GFP- Trap beads (ChromoTek) ...
-
bioRxiv - Microbiology 2023Quote: ... or High Pure Viral Nucleic Acid kit (Roche) kits ...
-
bioRxiv - Molecular Biology 2024Quote: ... Ethylenediamine tetraacetic acid -free protease inhibitor cocktail (Roche) was added fresh to the binding buffer ...
-
bioRxiv - Microbiology 2021Quote: ... samples were enzymatically analyzed using a D-Lactic Acid/L-Lactic Acid Enzymatic Bioanalysis UV-Test kit and a D-Glucose Enzymatic Bioanalysis UV-Test kit (Roche Diagnostics) with a modified manufacturer’s protocol to reduce total sample size to 300 uL ...
-
bioRxiv - Microbiology 2019Quote: Viral nucleic acid was extracted from 200µl of the filtrate using the High Pure viral nucleic acid kit (Roche Diagnostics, USA) following the standard protocol ...
-
bioRxiv - Immunology 2023Quote: 7-plex IF panel was created using the Ventana BenchMark Ultra (Roche Diagnostics) automated staining platform ...
-
bioRxiv - Developmental Biology 2023Quote: ... for nucleic acid hybridization and detection (BBR, Roche, 11096176001) in MAB buffer at RT for 90 min ...
-
bioRxiv - Neuroscience 2023Quote: ... using SYBR green as nucleic acid stain (Roche 4913850001). To specifically quantify mRNA expression ...
-
bioRxiv - Cancer Biology 2023Quote: ... The samples were immunostained for Ki67 (clone 30-9 at 1:7, Ventana- Roche), CD8 (clone SP57 at 1:7 ...
-
bioRxiv - Microbiology 2020Quote: ... total nucleic acid was extracted from 400 µl of cerebrospinal fluid using the MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche Diagnostics, Indianapolis, IN, USA) on the MagNA Pure compact automated extractor ...
-
bioRxiv - Developmental Biology 2019Quote: ... and detected with the DIG Nucleic Acid Detection Kit (Roche). Wing imaginal discs were mounted in glycerol and imaged with a Nikon E200 bright-field microscope.
-
bioRxiv - Molecular Biology 2019Quote: ... Nucleic acids were removed with 250 U of Benzonase (Roche) for 1 hr at 4° C ...
-
bioRxiv - Plant Biology 2020Quote: ... 10 mM ascorbic acid) containing a protease inhibitor cocktail (Roche). All subsequent steps were conducted on ice ...
-
bioRxiv - Plant Biology 2022Quote: ... and ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail cOmplete (Roche). For blocking and antibody dilutions ...
-
bioRxiv - Microbiology 2019Quote: ... albumin (5 g/L; fraction V, fatty acid-free, Roche) and tyloxapol (0.04%) ...
-
bioRxiv - Neuroscience 2021Quote: ... Okadaic acid (200nM) and a protease inhibitor cocktail (Roche Complete) with a Dounce homogenizer and solubilized for 1 hour rotating at 4°C ...
-
bioRxiv - Microbiology 2019Quote: ... albumin (5 g/L; fraction V, fatty acid-free, Roche) and tyloxapol (0.04%) ...
-
bioRxiv - Immunology 2021Quote: ... 0.25% sodium deoxycholic acid and complete protease inhibitor cocktail (Roche), pH 7.5 ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... The embryos were blocked in Blocking Buffer + Maleic Acid (Roche, 11585762001) for at least 3 hours before the anti-DIG antibody was added in a concentration of 1:5000 and incubated overnight at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.5% deoxycholic acid) containing inhibitors of phosphatases (1:10 PhosphoStop; Roche) and proteases (1:100 Protease Inhibitor Cocktail ...
-
bioRxiv - Biochemistry 2020Quote: ... followed by optional sialic acid removal using 0.02 U sialidase (Roche), prior to in-gel trypsin treatment49 ...
-
bioRxiv - Plant Biology 2020Quote: ... Digoxigenin was detected using DIG Nucleic Acid Detection Kit (Roche, USA).
-
bioRxiv - Microbiology 2022Quote: ... 0,002% mellitic acid and 1 pastil of protease inhibitors cocktail (Roche)).
-
bioRxiv - Neuroscience 2021Quote: ... 25 nM okadaic acid and a protease inhibitor cocktail tablet (Roche). Soluble and insoluble fractions of total homogenates were obtained as previously described (30) ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 x Protease Inhibitor cocktail ethylenediaminetetraacetic acid (EDTA)-free (PI, Roche), 10 mM NaF (Nacalai tesque) ...
-
bioRxiv - Biophysics 2022Quote: ... 1 tablet ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor (Roche diagnostics, GmbH), pH 8) ...
-
bioRxiv - Neuroscience 2023Quote: ... and ethylenediaminetetraacetic acid-free Complete Protease Inhibitor Cocktail (Roche Applied Science). After centrifugation at 20,000[×[g for 30 min at 4 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 tablet crushed complete EDTA (ethylenediaminetetraacetic acid)-free protease inhibitor (Roche), 0.5 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Immunology 2023Quote: ... human interleukin-2 (IL-2) (10 IU/ml, Roche), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 mM Tris-HCl (pH 7) and EDTA-free protease inhibitor cocktail (cOmplete™, Roche # 11873580001). After 30 min incubation on ice ...
-
bioRxiv - Genomics 2020Quote: ... 0.1% IGEPAL CA-630)7 supplemented with protease inhibitors (Complete Protease Inhibitor Cocktail, EDTA-free, Roche). Embryos were homogenized in a Dounce homogenizer then incubated in cold lysis buffer at 4°C for 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... and fractions 7–10 (cytosolic ribosomes) were pooled and treated with PCR grade proteinase K (Roche) in 1% SDS to release ribosome protected fragments ...
-
bioRxiv - Microbiology 2021Quote: ... and 100 U/mL human interleukin 2 (IL-2) (Roche) (Munoz et al. ...
-
bioRxiv - Microbiology 2021Quote: ... 2 M CaCl2 and 2 UU/ml DNAse I (Roche) for 30 min at 37°C ...
-
bioRxiv - Biophysics 2019Quote: ... and 30 IU/mL human interleukin-2 (hIL-2) (Roche).
-
bioRxiv - Biophysics 2021Quote: ... 2 mM MgCl2) supplemented with 2 protease inhibitor tablets (Roche), 1 mM PMSF ...
-
bioRxiv - Immunology 2023Quote: ... and 30 IU/mL human interleukin-2 (hIL-2) (Roche). To ectopically express Lifeact-eGFP or Lamp1-eGFP in CTLs ...
-
bioRxiv - Molecular Biology 2020Quote: ... in Tris calcium buffer with ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor (Roche) were added and the pellet resuspended ...
-
bioRxiv - Genetics 2021Quote: ... with the MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche Diagnostics) according to the manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Total RNA was isolated via MPLC Total Nucleic Acid Isolation Kit (Roche) using automated MagNA Pure LC Instrument (Roche) ...
-
bioRxiv - Neuroscience 2019Quote: ... pH 8.0) supplemented with ethylenediaminetetraacetic acid and cOmplete protease inhibitor cocktail (Roche Diagnostics ...
-
bioRxiv - Neuroscience 2019Quote: ... Slides were then blocked with 0.5% nucleic acid blocking reagent (Roche 11096176001) dissolved in a 1x PBS containing maleic acid (Sigma M0375 ...
-
bioRxiv - Genetics 2020Quote: ... acid-extracted histones were digested with Asp-N and Arg-C (Roche) and the resulting digests were analyzed by chromatography on an Ultimate 3000 nanoLC (Dionex ...