Labshake search
Citations for Roche :
201 - 250 of 2445 citations for 7 Hydroxy 4 oxo 8 propyl 4H chromene 2 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... total nucleic acid was extracted from 400 µl of cerebrospinal fluid using the MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche Diagnostics, Indianapolis, IN, USA) on the MagNA Pure compact automated extractor ...
-
bioRxiv - Genetics 2021Quote: ... with 3x protease inhibitors (cOmplete Protease Inhibitor Cocktail EDTA-free - 1 mM phenylmethylsulfonyl fluoride, 4 mM benzamidine, 2 μg/ml leupeptin, and 1 μg/ml pepstatin, Roche Diagnostics, cat. number 1187358001) and 3x phosphatase inhibitors (Millipore Inhibitor Cocktail Set ...
-
bioRxiv - Cell Biology 2022Quote: ... After three washes with PBS containing 0.5% Tween-20 samples were incubated with fluorescent labelled secondary antibodies containing 4′,6-diamidino-2-phenylindole (DAPI; Roche Cat# 10236276001, 1.0 µg/ml) for 30 min ...
-
bioRxiv - Developmental Biology 2019Quote: ... and detected with the DIG Nucleic Acid Detection Kit (Roche). Wing imaginal discs were mounted in glycerol and imaged with a Nikon E200 bright-field microscope.
-
bioRxiv - Molecular Biology 2019Quote: ... Nucleic acids were removed with 250 U of Benzonase (Roche) for 1 hr at 4° C ...
-
bioRxiv - Plant Biology 2020Quote: ... 10 mM ascorbic acid) containing a protease inhibitor cocktail (Roche). All subsequent steps were conducted on ice ...
-
bioRxiv - Plant Biology 2022Quote: ... and ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail cOmplete (Roche). For blocking and antibody dilutions ...
-
bioRxiv - Microbiology 2019Quote: ... albumin (5 g/L; fraction V, fatty acid-free, Roche) and tyloxapol (0.04%) ...
-
bioRxiv - Neuroscience 2021Quote: ... Okadaic acid (200nM) and a protease inhibitor cocktail (Roche Complete) with a Dounce homogenizer and solubilized for 1 hour rotating at 4°C ...
-
bioRxiv - Microbiology 2019Quote: ... albumin (5 g/L; fraction V, fatty acid-free, Roche) and tyloxapol (0.04%) ...
-
bioRxiv - Immunology 2021Quote: ... 0.25% sodium deoxycholic acid and complete protease inhibitor cocktail (Roche), pH 7.5 ...
-
bioRxiv - Genomics 2020Quote: ... Muscles were digested with 8 mg/ml Collagenase D (Roche, Basel, Switzerland) and 10 U/ml Dispase II (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: ... which had been pre-treated with 8 μg/ml mitomycin C (Roche). Throughout the immortalization process ...
-
An optimized ChIP-Seq framework for profiling of histone modifications in Chromochloris zofingiensisbioRxiv - Genomics 2021Quote: ... The ligated products were enriched with 8 cycles of PCR (KAPA biosystems) and size selected to 200-500 bp with Total Pure NGS beads (Omega Bio-tek) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 8 M Urea loading dye was supplemented with complete protease inhibitor (Roche). 100 μl Urea loading dye were used to resuspend cell pellet after NaOH treatment ...
-
bioRxiv - Molecular Biology 2021Quote: ... which had been pre-treated with 8 μg/ml mitomycin C (Roche). Throughout the immortalization process ...
-
bioRxiv - Cancer Biology 2023Quote: ... 50mM Tris-HCl (pH 8) + protease inhibitor cocktail (PIC, cOmplete Mini, Roche)] and sonicated under optimized conditions that yielded an average DNA length of ∼300 bp ...
-
bioRxiv - Systems Biology 2023Quote: ... Muscles were digested with 8 mg/ml Collagenase D (Roche, Basel, Switzerland) and 10 U/ml Dispase II (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 mM Tris pH 8 in water) with Protease inhibitors (Roche, 11836170001). WCL lysate was incubated on ice for 30 min and centrifuged at max speed for 10 min to remove debris ...
-
bioRxiv - Molecular Biology 2023Quote: ... pH 8) supplemented with cOmplete™ EDTA-free protease inhibitor tablets (Roche) and Benzonase® nuclease ...
-
Dysregulated expanded endocannabinoid system as therapeutic targets of amyotrophic lateral sclerosisbioRxiv - Neuroscience 2024Quote: Cell viability assays were performed using a WST-8 kit (Roche Diagnostics) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... 8 M Urea and 1x cOmpleteTM EDTA-free protease inhibitor (Roche #11873580001). Lysates were sonicated with a probe sonicator and cleared via centrifugation at 15,000x g for 30 min ...
-
bioRxiv - Immunology 2019Quote: ... and hematoxylin (4 minute incubation) and Bluing Reagent (4 minute incubation) counterstain (Roche, Ventana Medical Systems ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... The embryos were blocked in Blocking Buffer + Maleic Acid (Roche, 11585762001) for at least 3 hours before the anti-DIG antibody was added in a concentration of 1:5000 and incubated overnight at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.5% deoxycholic acid) containing inhibitors of phosphatases (1:10 PhosphoStop; Roche) and proteases (1:100 Protease Inhibitor Cocktail ...
-
bioRxiv - Biochemistry 2020Quote: ... followed by optional sialic acid removal using 0.02 U sialidase (Roche), prior to in-gel trypsin treatment49 ...
-
bioRxiv - Plant Biology 2020Quote: ... Digoxigenin was detected using DIG Nucleic Acid Detection Kit (Roche, USA).
-
bioRxiv - Microbiology 2022Quote: ... 0,002% mellitic acid and 1 pastil of protease inhibitors cocktail (Roche)).
-
bioRxiv - Neuroscience 2021Quote: ... 25 nM okadaic acid and a protease inhibitor cocktail tablet (Roche). Soluble and insoluble fractions of total homogenates were obtained as previously described (30) ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 x Protease Inhibitor cocktail ethylenediaminetetraacetic acid (EDTA)-free (PI, Roche), 10 mM NaF (Nacalai tesque) ...
-
bioRxiv - Biophysics 2022Quote: ... 1 tablet ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor (Roche diagnostics, GmbH), pH 8) ...
-
bioRxiv - Neuroscience 2023Quote: ... and ethylenediaminetetraacetic acid-free Complete Protease Inhibitor Cocktail (Roche Applied Science). After centrifugation at 20,000[×[g for 30 min at 4 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 tablet crushed complete EDTA (ethylenediaminetetraacetic acid)-free protease inhibitor (Roche), 0.5 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Immunology 2023Quote: ... human interleukin-2 (IL-2) (10 IU/ml, Roche), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4-toluidine salt (BCIP, Roche) in NTMT buffer ...
-
bioRxiv - Microbiology 2023Quote: ... 4 U DNase I (Roche) with the reaction buffer provided with the enzyme for 20 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 mM MgCl2 (Roche Diagnostics), 0.3 µM of each primer (RB1_80F and RB1_235R ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 mM EDTA pH 8) in presence of Complete Protease Inhibitor Cocktail (Roche) and Halt Phosphatase Inhibitor Cocktail (Pierce) ...
-
bioRxiv - Biochemistry 2021Quote: ... pH 8) containing one tablet of cOmplete EDTA-free Protease Inhibitor Cocktail (Roche). Cells were lysed via two passages through a French pressure cell at 1,500 psi ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the remaining 21865 reads (∼8 Mb) were submitted for assembly by Newbler (Roche). Of the 6309 obtained contigs (N50 = 663 bp) ...
-
bioRxiv - Microbiology 2021Quote: ... pH 8 (buffer A) supplemented with EDTA free complete protease inhibitor tablets (Roche). The cells were lysed using a French press at 18000 psi ...
-
bioRxiv - Cell Biology 2022Quote: Conjugation of protein or nanobody was performed with an 8-fold (Laminin; Roche) or 4-fold (R2-myc-his ...
-
bioRxiv - Genetics 2023Quote: ... with 6-8 cycles of PCR amplification using KAPA-HiFi (Kapa Biosystems, KK2602). DNA library was sequenced using an Illumina NextSeq 500 75-cycle high output kit.
-
bioRxiv - Cell Biology 2021Quote: ... 20 mM Tris-HCl (pH 7) and EDTA-free protease inhibitor cocktail (cOmplete™, Roche # 11873580001). After 30 min incubation on ice ...
-
bioRxiv - Genomics 2020Quote: ... 0.1% IGEPAL CA-630)7 supplemented with protease inhibitors (Complete Protease Inhibitor Cocktail, EDTA-free, Roche). Embryos were homogenized in a Dounce homogenizer then incubated in cold lysis buffer at 4°C for 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... and fractions 7–10 (cytosolic ribosomes) were pooled and treated with PCR grade proteinase K (Roche) in 1% SDS to release ribosome protected fragments ...
-
bioRxiv - Microbiology 2020Quote: ... NimbleGen 4-plex arrays containing 4 × 72,000 arrays per slide were used (Roche, Mannheim, Germany). Construction of this chip was initially based on combining two previous genome annotations (Amselem et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 μg of plasmid and 4 μl of X-tremeGENE HP DNA Transfection Reagent (Roche) were used per well ...
-
bioRxiv - Developmental Biology 2024Quote: ... NBT/BCIP (4-nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indolylphosphate, Roche, 11681451001) was added after thoroughly washing samples ...