Labshake search
Citations for Roche :
601 - 650 of 2872 citations for 7 Bromo 6 chloro 3 3 3 hydroxy 2 piperidyl 2 oxopropyl quinazolin 4 3H one monohydrobromide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: Transcriptional start sites (TSS) of rokL6 and sco1448 were determined by 5’ RACE using a 5’/3’ RACE Kit 2nd generation (Roche, California, US). Total RNA (2 μg ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM PMSF, 3 mM ATP, 10% sucrose and Roche protease inhibitors). For sS1 constructs ...
-
bioRxiv - Biochemistry 2024Quote: ... 20 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 10% sucrose, 3 mM ATP, 1 mM DTT, 1 mM PMSF and Roche Protease Inhibitors), 1 ml per dish ...
-
bioRxiv - Developmental Biology 2019Quote: ... 2% blocking reagent (Roche), 20% heat inactivated goat serum and then incubated overnight with anti-DIG antibody (Roche ...
-
bioRxiv - Biochemistry 2020Quote: For Figures 2 and 6: Cells or embryos were lysed in RIPA buffer supplemented with a cocktail of protease inhibitor (Roche). Total protein was resolved on SDS polyacrylamide gels (Bio-Rad ...
-
bioRxiv - Plant Biology 2022Quote: ... Glucose content was then measured by spectrophotometry after a 2 enzymes reaction with hexokinase and glucose-6-phosphate dehydrogenase (Roche).
-
bioRxiv - Cell Biology 2020Quote: ... They were allowed to equilibrate in rigor buffer (20 mM HEPES pH 7, 140 mM KCl, 2 mM MgCl2, 1 mM EGTA, 1 mM DTT, Roche complete protease inhibitor) over night at 4 °C ...
-
bioRxiv - Immunology 2022Quote: ... Proliferating cells remaining in the cultures were further expanded by incubating for a further 7 days with 20 IU/mL IL-2 (Roche Life Science Products). After expansion ...
-
bioRxiv - Microbiology 2020Quote: We obtained OP and NP samples from one hospitalised COVID-19 patient who had tested virus-positive three weeks earlier (cobas® SARS-CoV-2 test, Roche diagnostics), from three individuals who had previously tested SARS-CoV-2 positive ...
-
bioRxiv - Cancer Biology 2023Quote: ... and recombinant mouse interleukin-2 (mIL-2, 100 U/ml; Roche, Basel, Switzerland), and subjected to flow cytometry as described elsewhere ...
-
bioRxiv - Neuroscience 2023Quote: ... 150 μL of RIPA double-detergent buffer (2% deoxycholate, 2% NP-40, 2% Triton X-100 in RIPA homogenizing buffer) supplemented with protease inhibitor cocktail (Roche, cat# A32953) was added to the tissue homogenate followed by incubation on a shaker for 1 h at 4ºC ...
-
bioRxiv - Cell Biology 2024Quote: ... just after the resection the tissue was dissociated into small pieces (∼2 mm × 2 mm × 2 mm) and then digested for 30 minutes at 37°C with Collagenase (2 mg/mL, Roche, Basel, Switzerland) and DNase I (400 U/mL ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Developmental Biology 2020Quote: ... Enrichment of 2 μg of an indexed library incubated with 3 μM of a pool of biotinylated oligonucleotides was performed using the SeqCap EZ Hybridization reagent kit (Roche/NimbleGen, Lot # 05634261001), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 μg/ml taxol, 3 U/ml DNAse I, 10 μg/ml RNAse A, 1 U/ml micrococcal nuclease, and Roche Complete Protease Inhibitors) and vortexed vigorously for 1 min ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgOAc, 5 %w/v glycerol, 0.25 %w/v NP-40, 3 mM DTT, 1 mM PMSF, Roche protease inhibitor cocktail (PIC), pH 7.5 ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Plant Biology 2024Quote: ... Samples were mounted in Citifluor AF1(Agar Scientific, Cat No: AGR1320)/PBS solution (3:1) with (optional a DAPI (Roche, Cat No: 10236276001) to a final concentration of 10µg.ml−1 ...
-
bioRxiv - Cell Biology 2022Quote: ... before being detached with 40 μL of ice-cold native lysis buffer (80 mM PIPES pH 6.9, 2 mM MgCl2, 4 mM EGTA, 0.2% saponin, 5x cOmplete protease inhibitor cocktail Roche). The lysate was collected in 1.5 mL tube and incubated on ice for 10 min ...
-
bioRxiv - Microbiology 2021Quote: ... 1% Triton X-100, 150 mM NaCl, 10% glycerol, and 2 mM EDTA plus one Complete EDTA-free protease inhibitor tablet [Roche] per 50 ml) for 1 hr ...
-
bioRxiv - Cell Biology 2021Quote: ... and phosphatase inhibitors (2 mM activated Na3VO4, 2 mM NaF and 1x PhosSTOP (Roche)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... plates were fixed with 2% paraformaldehyde/ 2% sucrose and stained with DAPI (#10236276001, Roche). Plates were photographed with the IN Cell Analyzer 2200 high content analyzer (GE Healthcare) ...
-
bioRxiv - Immunology 2024Quote: ... 2 mM L-Glutamine (R10) (Thermo 25030081) + 10 IU/mL IL-2 (Roche 11011456001) after CD3/CD28 stimulation ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.1% Tween-20] and maintained for 2 hours in 2% blocking reagent (11096176001, Roche) in TNT ...
-
bioRxiv - Immunology 2019Quote: ... human recombinant IL-2 (Roche) was also added fresh immediately prior to use at a final concentration of 100 IU/ml ...
-
bioRxiv - Biophysics 2019Quote: ... 2 mM creatine phosphate (Roche), 10 ng/µL creatine kinase (Roche) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2% Blocking reagent (Roche, 11096176001), 0.1% Tween 20 ...
-
bioRxiv - Neuroscience 2020Quote: ... using 2 % blocking reagent (Roche), followed by the detection of the Dig-labelled riboprobe with an anti-DIG Fab fragment conjugated with alkaline phosphatase (1:750 ...
-
bioRxiv - Microbiology 2020Quote: ... 2 U Lactate dehydrogenase (Roche) and 10 µg PGAM was pre-warmed to 30 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2% blocking reagent (Roche – 1096176001), 20% heat-inactivated goat serum and then incubated overnight with anti-DIG-AP antibody (Roche – 11093274910 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2× Protease Inhibitor Cocktail (Roche), 2 mM 2-mercaptoethanol ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2% Nutridoma-CS (Roche) for 6 days39 ...
-
bioRxiv - Biophysics 2020Quote: ... 2 mM creatine phosphate (Roche), 10 ng μL−1 creatine kinase (Roche) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were washed in PBSTr and incubated overnight at 4 °C MABTr/10% sheep serum (Sigma-Aldrich)/2% Blocking solution (Roche, Switzerland) with anti-Fluorescein-POD Fab fragments serum (1:500 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were incubated overnight at 4°C in 0.1M malic acid/0.1%-TritonX (MABTr)/10% sheep serum (Sigma-Aldrich)/2% Blocking solution (Roche, Switzerland) with anti-DIG-AP Fab fragments serum (1:5000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... embryos were incubated overnight at 4 °C in blocking solution MABTr/10% sheep serum (Sigma-Aldrich)/2% Blocking solution (Roche, Switzerland) with anti-DIG-POD Fab fragments serum (1:500 ...
-
bioRxiv - Microbiology 2022Quote: ... version 2 (Roche, Basel, Switzerland), with a lower limit of detection of 20 copies/ml of plasma.
-
bioRxiv - Biochemistry 2022Quote: ... 2 mM amino acids (Roche), 1 nM pY71sfGFP plasmid encoding superfolder GFP (M ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 mg DNase I (Roche) and triton X-100 to 1% were added ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... 2% blocking reagent (Roche, #11096176001), 10% heat-inactivated sheep serum (Equitech-Bio ...
-
bioRxiv - Immunology 2023Quote: ... 2 μg/ml Histon (Roche), 1 μg/ml Sm/RNP (GenWay) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 mg/mL BSA (Roche), 60 µg/mL catalase (Sigma) ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 mM creatine phosphate (Roche), 10 µg/ml creatine kinase (Roche) ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 mM GTPgS (Roche, 10220647001) and 4 mM MgCl2 in BRB80 was incubated for 5 hours at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 protease inhibitor tablets (Roche), 20 M MG132 (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2023Quote: ... in 2% Blocking Reagent (Roche) and 5% sheep serum (Sigma ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 PhosSTOP easy Pack (ROCHE), Protease Inhibitor cocktail (Sigma) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µg BSA (Roche Diagnostics) and 1 U Immolase DNA polymerase (Meridian Bioscience ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was reverse transcribed using Transcriptor High Fidelity cDNA Synthesis Kit and a specific 3’-UTR DENV-1 primer (Roche Applied Science, Mannheim, Germany), d1a5B 5’-AGAACCTGTTGATTCAACRGC-3’ (62) ...
-
bioRxiv - Plant Biology 2021Quote: ... was isolated from the cDNA of juvenile cluster root tissues from P-deficient plants using the 5’/3’ RACE Kit (2nd generation, Roche Diagnostics S.p.a., Monza, Italy) following the manufacturer’s instructions ...