Labshake search
Citations for Roche :
601 - 645 of 645 citations for 7 Bromo 3 methyl 1H indole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: ... a 6.7 kb DNA fragment starting 1 kb upstream of murine Gnrhr exon 3 was amplified by PCR using the Expand Long Template PCR System (Roche, Basel, Switzerland) from 129SvEv genomic DNA using primers incorporating 5’ XmaI and 3’ NotI restriction enzyme sites (Table 1) ...
-
bioRxiv - Cell Biology 2021Quote: Total protein from cells or mouse tissues (n=3 per genotype) were extracted using the M-PER protein lysis buffer (ThermoScientific, Beverly, MA) containing protease inhibitors (Roche, Indianapolis, IN). Approximately 25 μg of total protein was electrophoresed on 4-12% SDS-PAGE gels and transferred to PVDF membranes ...
-
bioRxiv - Physiology 2022Quote: ... n=3/genotype) were used for terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) to visualize cell apoptosis/death (Roche, Basel, Switzerland). Sections were counterstained with DAPI and visualized using epifluorescence (Nikon Eclipse Ni E800) ...
-
bioRxiv - Microbiology 2022Quote: ... 45 cycles of 95°C for 3 s and 60°C for 30 s using the LightCycler 96 system (Roche, Basel, Switzerland) or the StepOnePlus™ Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... and 3-4 mice/group subcutaneously received 25ng/g of pegylated-human interferon α (Peg-hIFNα-2a) (Hoffmann La Roche, Basel, Switzerland). To activate IFN-1 signaling ...
-
bioRxiv - Genomics 2022Quote: ... Empty/filled PCRs (combining 5′ and 3′ flanking primers) and full-length PCRs (using junction-spanning primers) were performed using an Expand Long Range dNTPack (Roche, Cat#: 4829034001). Reaction mixes contained 5μL 5× Expand Long Range Buffer with 12.5mM MgCl2 ...
-
bioRxiv - Cancer Biology 2019Quote: ... MA; N3500], 50mM of Tris [pH 7.5], 150 mM of NaCl, 3 mM of MgCl2, 1X protease inhibitors [Roche, Mannheim, Germany; 05892953001]). Protein concentration was measured using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pellet was resuspended in Buffer 2 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5 % IGEPAL CA-630, 10 % glycerol, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 10 min followed by a centrifugation step ...
-
bioRxiv - Immunology 2020Quote: ... Membranes were blocked for 1 h with 3% (w/v) non-fat milk powder in PBS/0.1% (v/v) Tween (PBST) (CALR, 10% Roche WBR in PBST) and incubated with primary antibody (Supplementary Table III ...
-
bioRxiv - Neuroscience 2020Quote: ... the pellet was washed 3 times with the buffer B and transferred in an enzyme solution (2 mg/mL Collagenase/Dispase (Roche, Bale, Switzerland), 0,147 µg/mL TLCK (Lonza ...
-
bioRxiv - Immunology 2021Quote: ... was incubated with 50μl MTT (sodium 3′-[1-(phenylaminocarbonyl)-3,4-tetrazolium]-bis (4-methoxy-6-nitro) benzene sulfonic acid hydrate) labeling reagent (Roche Life Science, USA) to each well ...
-
bioRxiv - Biophysics 2019Quote: ... or for confocal in a alkaline-washed glass-bottomed chamber coated with human plasma fibronectin (25 µg/mL at 4°C overnight in 1/3 X MBS; Roche Molecular Biochemicals) in DFA supplemented with antibiotic/antimycotic (Sigma) ...
-
bioRxiv - Genetics 2021Quote: ... and cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C followed by a centrifugation step ...
-
bioRxiv - Genetics 2021Quote: ... 30 million equivalent cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C and collected cells by a centrifugation step ...
-
bioRxiv - Genetics 2021Quote: ... The T7 promoter was added to the 5’ and 3’ ends to synthesize the sense and anti-sense probes using the DIG RNA Labeling Kit (Roche, Cat# 11175025910). In situ hybridization was performed as previously described [65,66] with minor modifications ...
-
bioRxiv - Microbiology 2020Quote: ... and prepared for shotgun metagenomic sequencing using the Kapa Hyperprep Plus kit with 3 rounds of PCR amplification (Kapa Biosystems, Wilmington, MA), and sequenced to an average depth of 7 gbp per fraction on the Illumina NovaSeq (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... qRT-PCR reactions were carried out in triplicates following a 3-step amplification protocol using the LightCycler 480 system (Roche Diagnostics, Switzerland). The ΔΔCT method [94] was used to calculate gene expression changes relative to housekeeping genes β-actin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) ...
-
bioRxiv - Microbiology 2023Quote: ... Abutting primer pairs were designed that were specific to these genetic groups (Supplementary Table 3) to enable the recovery of full viral genomes using polymerase chain reaction (PCR) with HiFi HotStart DNA polymerase (Kapa Biosystems, USA) using cycling conditions per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... ∼0.5×106cells were collected and wash 3 times with Wash buffer (20 mM HEPES-KOH, pH 7.5,150mM NaCl, 0.5mM Spermidine, and Roche Complete Protease Inhibitor EDTA-free). Cells were captured with BioMagPlus Concanavalin A (Polysciences ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cells were lysed in 50 µl of lysis buffer (10 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% NP-40, 1× Roche Complete protease inhibitors cocktail) by pipetting up and down ...
-
bioRxiv - Biophysics 2023Quote: ... 150 mM NaCl, 10% sucrose, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 3 mM ATP, 1 mM PMSF and Roche protease inhibitors). Native mouse regulatory light chain (RLC ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 mM β-mercaptoethanol (BME) and 0.3 μg/ml DNase I supplemented with 600 μl of protease inhibitor cocktail (Roche, Basel, Switzerland) and 5 mg lysostaphin (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: Transcriptional start sites (TSS) of rokL6 and sco1448 were determined by 5’ RACE using a 5’/3’ RACE Kit 2nd generation (Roche, California, US). Total RNA (2 μg ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM PMSF, 3 mM ATP, 10% sucrose and Roche protease inhibitors). For sS1 constructs ...
-
bioRxiv - Biochemistry 2024Quote: ... 20 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 10% sucrose, 3 mM ATP, 1 mM DTT, 1 mM PMSF and Roche Protease Inhibitors), 1 ml per dish ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Developmental Biology 2020Quote: ... Enrichment of 2 μg of an indexed library incubated with 3 μM of a pool of biotinylated oligonucleotides was performed using the SeqCap EZ Hybridization reagent kit (Roche/NimbleGen, Lot # 05634261001), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 μg/ml taxol, 3 U/ml DNAse I, 10 μg/ml RNAse A, 1 U/ml micrococcal nuclease, and Roche Complete Protease Inhibitors) and vortexed vigorously for 1 min ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgOAc, 5 %w/v glycerol, 0.25 %w/v NP-40, 3 mM DTT, 1 mM PMSF, Roche protease inhibitor cocktail (PIC), pH 7.5 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 80 µl of dephosphorylation solution (8 μl 10x dephosphorylation buffer, 2 μl RNasin Plus, 67 μl ddH2O, and 3 μl alkaline phosphatase (Roche, catalog no. 10713023001)) was added to the beads ...
-
bioRxiv - Molecular Biology 2021Quote: ... For isolation of nuclei the cell pellet was resuspended in Buffer 1 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 20 min followed by a centrifugation step ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells at 70% confluence were harvested by trypsinization (after 3-4 hours treatment with 100 ng/mL colcemid [Roche #10295892001] for metaphase spreads), washed with PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... 20 mg protein was loaded onto 8-10% SDS-PAGE gels for electrophoresis and subsequently transferred (90 V, 2-3 h) onto PVDF western blotting membranes (Roche, Cat. No. 3010040001) using the Criterion™ System BioRad ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Plant Biology 2024Quote: ... Samples were mounted in Citifluor AF1(Agar Scientific, Cat No: AGR1320)/PBS solution (3:1) with (optional a DAPI (Roche, Cat No: 10236276001) to a final concentration of 10µg.ml−1 ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was reverse transcribed using Transcriptor High Fidelity cDNA Synthesis Kit and a specific 3’-UTR DENV-1 primer (Roche Applied Science, Mannheim, Germany), d1a5B 5’-AGAACCTGTTGATTCAACRGC-3’ (62) ...
-
bioRxiv - Plant Biology 2021Quote: ... was isolated from the cDNA of juvenile cluster root tissues from P-deficient plants using the 5’/3’ RACE Kit (2nd generation, Roche Diagnostics S.p.a., Monza, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... initial denaturation at 95°C for 3 min, followed by 40 cycles of amplification (95°C for 15 sec, 60°C for 30 sec) (Roche LightCycler 96, Roche Diagnostics). For absolute quantification ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR primer for generating the probe was 5’-GGTTCTGTGATTGAGTGTTTGGATCTCCCTGCG-3’ with a single-end CY3 tag generated using the DIG RNA Labeling Kit (Roche Applied Science, Penzberg, Germany) based on the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by 10 minutes at 37°C in a 3% (w/v) collagenase A solution in PBS (Collagenase A, Roche Diagnostics GmbH, Germany, 10103586001). Cells were recovered by centrifugation for 5 minutes at 300g prior cell counting on Malassez cells after Trypan blue staining ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries for target enrichment of ∼3 Mb of Lupinus angustifolius genomic material were produced using the Roche Sequencing Solutions’ ‘SeqCap EZ – HyperPlus’ kit (Roche Sequencing Solutions, Pleasanton, CA) with 200 ng/L of input DNA.
-
bioRxiv - Developmental Biology 2023Quote: ... Reverse transcription (RT) was performed from 2-3 µg of RNA with the Transcriptor First Strand cDNA Synthesis Kit (Roche Life Sciences, Basel, Switzerland) using random hexamer primers ...
-
bioRxiv - Microbiology 2024Quote: ... and phoC-A-R1 (5’-CAA CAT CGC TTT GCC AGT G-3’) (Fraser et al., 2017) with a Roche LightCycler® 96 (Roche Diagnostics, Mannheim, Germany) using 5 µL KAPA SYBR FAST 2x qPCR Master Mix (KAPA Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... and then incubated overnight with primary antibody (monoclonal anti-FLAG, 1:1,000; Sigma-Aldrich, #F1804-1MG; or anti-GFP, 1:1000, Roche #11814460001 in 3% BSA/TBS-T) at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... pellets were resuspended in 100 µL of lysis buffer (50 mM Tris pH 7.5, 1 mM EDTA, 3 mM DTT, 1X cOmplete protease inhibitor cocktail [SKU, 11836145001, Roche], 1.1 mM PMSF, and 1X Pepstatin A) and beaten on a bead-beater for 5 minutes at room temperature with 100 µL of acid-washed glass beads (cat ...