Labshake search
Citations for Roche :
201 - 250 of 6913 citations for 7 Bromo 2 Methyl 1 Indanone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... cell pellets were treated with 1 mL of 2 mg/mL lysozyme (Roche, Switzerland) and incubated at 30 °C for 10 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% penicillin-streptomycin) and treated with 2 units/mL of DNase I (Roche Diagnostics) for 15 minutes at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% penicillin-streptomycin) and treated with 2 units/mL of DNase I (Roche Diagnostics) for 15 minutes at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Epidermis was separated from dermis by Dispase 2 (1:100, Roche #04942078001, 20mg/mL), digested in PBS at 37°C for one hour before being peeled off ...
-
bioRxiv - Developmental Biology 2024Quote: ... cells were stained with 4′,6-diamidino-2-phenylindole (DAPI) (Roche, 10236276001; 1:10,000) for 5 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 mM 2-Mercaptoethanol and 6 cOmplete EDTA-free protease inhibitor Cocktail tablets (Roche), pH 8.0) ...
-
bioRxiv - Biochemistry 2024Quote: ... 250 mg of powder was thawed at 4°C followed by resuspension in 1 mL of HIP buffer (40 mM HEPES-KOH pH 7.5, 110 mM KOAc, 2 mM MgCl2, 1% Triton X-100, 0.1% Tween, 1x protease inhibitor cocktail [Roche], 1% solution P, 1 mM DTT). The lysate was next passed through a Whatman 25 mm GD/X Disposable filter (Cat No ...
-
bioRxiv - Bioengineering 2019Quote: ... three times and transferred to a petri-dish containing 2 ml of protease solution (1 mg/ml of 1 unit/mg Dispase II (Roche Diagnostics Corporation ...
-
bioRxiv - Developmental Biology 2019Quote: ... tissues were washed with ice cold PBS and lysed in lysis buffer (1 mM PMSF, 2 mM Na3VO4, 1× protease and phosphatase inhibitor cocktail tablets without EDTA from Roche Applied Science ...
-
bioRxiv - Cancer Biology 2019Quote: ... and then resuspended in lysis buffer (10 mM Hepes-NaOH, 100 mM NaCl, 2 mM EDTA, 1 mM EGTA, 1 mM PMSF, 0.2% SDS, 0.1% sarkozyl, Roche proteases inhibitor). Sonication was performed with a Misonix sonicator (fifteen cycles of 20 seconds sonication interspaced by a pause of 50 seconds) ...
-
bioRxiv - Biochemistry 2022Quote: Proteins were extracted from adherent cells by scraping into extraction buffer (1× LysisM, 1× protease inhibitor cocktail, 2 x phosphatase inhibitor cocktail (all Roche), 2 mM sodium orthovanadate (Sigma ...
-
bioRxiv - Biochemistry 2019Quote: ... with buffer II with protease inhibitors (8 μg/ml Aprotinin, 10 μg/ml Leupeptin, 1 μg/ml Pepstatin, 1 mM PMSF and 2 tablets cOmplete Mini, EDTA free; Roche) and 2 times flash frozen in liquid Nitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... and low-volume supernatants (90 μL media per well of a 48-well plate) were mixed 1:1 with 2× SDS/PAGE sample buffer containing Complete Mini EDTA-free Protease Inhibitor Mixture (Roche). In experiments where primary hMDMs were plated in a 24-well plate and infected with T4SS-Lp ...
-
bioRxiv - Developmental Biology 2023Quote: ... sections were washed three times with TBST and then incubated with appropriate secondary antibodies (2 µg/mL in TBST / 1% bovine serum albumin (BSA)) and 1 µg/mL DAPI (Roche) for one hour at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... Isolated tissue was cut in pieces of 2 cm and digested for 1h at 37°C in a HBSS solution containing 1% P/S and 2 U ml-1 Dispase II (Roche). Epidermal layer was separated from the dermis using two tweezers ...
-
bioRxiv - Cancer Biology 2024Quote: ... HEK293T cells were co-transfected with sgRNA expression vectors and lentiviral packaging constructs psPAX2 and pMD2.G (VSV-G) in a 2:1:1 ratio using X-tremeGENE 9 DNA Transfection Reagent (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5% Triton X-100, 10 mM N-methyl maleimide (general DUB inhibitor diluted in DMSO, freshly added) and protease inhibitors (Roche Diagnostics, EDTA-free, freshly added). Then ...
-
bioRxiv - Biochemistry 2021Quote: ... except that all digests contained 200 µg/mL fibrils and 40 µg/mL pronase E and that the digest was stopped in each 20 µL aliquot with 2 µL protease inhibitor cocktail solution (1 tablet cOmplete EDTA-free Protease Inhibitor Cocktail, Roche, in 2 ml pure water) instead of PMSF solution ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Cell Biology 2019Quote: ... 125 mM NaCl, 1% NP-40, 2 mM EDTA, 1 mM PMSF [Sigma, 93482-50ML-F], and protease inhibitor cocktail [Roche, 000000011836170001) and incubated on ice for 25 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 200 mM NaCl, 2 mM MgAc2, 1% [w/v] LMNG, 1 mM DTT, 1x complete EDTA-free protease inhibitor cocktail [Roche, Germany]). After 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... 200 mM NaCl; 2 mM MgAc; 1% [w/v] LMNG, 1 mM DTT, 1x complete EDTA-free protease inhibitor cocktail [Roche, Germany]) per 1 g of cell pellet and incubated for 30 min at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 mM NaCl, 2 mM MgCl2, 10 mM NaF, 1 mM PMSF, 1% Triton X-100 and Complete Protease inhibitor mixture, Roche Diagnostics) for 45 min on ice and centrifuged at 20000g for 10 min at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were then mechanically lysed (MagNAlyzer Roche – 6000 rpm, 1 min on, 2 min off) in the presence of 300 uL acid-washed glass beads (Sigma-Aldrich).
-
bioRxiv - Biochemistry 2021Quote: ... 1 mM Tris(2-carboxyethyl)phosphin (TCEP) with complete EDTA-free protease inhibitor cocktail (Roche) and 10 µg/ml DNAseI (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1 mM tris(2-carboxyethyl)phosphine [TCEP]) supplemented with EDTA-free protease inhibitors (Roche). The lysate was clarified by centrifugation (17,000 rpm for 1 h at 4°C ...
-
bioRxiv - Immunology 2020Quote: ... diluted 2-fold with PBMC culture media and supplemented with 10% WST-1 reagent (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM PMSF) supplemented with 1 protease inhibitor cocktail tablet (cOmplete-EDTA free, Roche, #11836170001) to a final volume of 50 mL ...
-
bioRxiv - Genetics 2022Quote: ... sections were incubated with DAPI (4′,6-diamidino-2-phenylindole dihydrochloride, Roche, 1:250 dilution) for 10 sec and washed in PBS.
-
bioRxiv - Developmental Biology 2023Quote: ... was diluted 1 in 50 in solution consisting of 2 % blocking reagent (Roche ref 11096176001), 1 % goat serum (Gibco ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cell nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, 1 μg/mL, Roche). To reduce autofluorescence ...
-
bioRxiv - Immunology 2023Quote: ... human interleukin-2 (IL-2) (10 IU/ml, Roche), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 mM Tris-HCl (pH 7) and EDTA-free protease inhibitor cocktail (cOmplete™, Roche # 11873580001). After 30 min incubation on ice ...
-
bioRxiv - Genomics 2020Quote: ... 0.1% IGEPAL CA-630)7 supplemented with protease inhibitors (Complete Protease Inhibitor Cocktail, EDTA-free, Roche). Embryos were homogenized in a Dounce homogenizer then incubated in cold lysis buffer at 4°C for 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... and fractions 7–10 (cytosolic ribosomes) were pooled and treated with PCR grade proteinase K (Roche) in 1% SDS to release ribosome protected fragments ...
-
bioRxiv - Cancer Biology 2021Quote: ... were prepared using the IP buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1% TritonX-100, 0.5% Na-DOC, 1 mM EDTA, 2 mM PMSF and 1x Roche protease inhibitor cocktail). After sonification for 5 min and clarification with centrifuge at 16,000 g at 4 °C ...
-
bioRxiv - Physiology 2021Quote: ... 1:500 goat anti-rabbit (AlexaFlour 488; A-11008) and 1:1000 4′,6-diamidino-2-phenylindole (DAPI; Roche 10236276001; Basel, Switzerland). After secondary incubations ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were stained with secondary antibodies (1:300) for 2 hours at room temperature and nuclei stained with DAPI (1:1000, Roche, Munich, Germany). The cells were mounted using the ProLong Diamond antifade mountant (Thermo ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mM PMSF and 1 tablet/80 ml of complete EDTA-free protease inhibitor cocktail (Roche)] ...
-
bioRxiv - Immunology 2019Quote: ... with both basic (Cell Conditioner 1) and mildly acidic (Cell Conditioner 2) antigen retrieval methods (Roche, Ventana Medical Systems ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM MgCl2) supplemented with 1% Triton-X100 and a mini complete protease inhibitor pill (Roche). Lysates were centrifuged at 20,000 × g for 15 min at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% Triton X-100 and 2 mM phenylmethylsulfonyl fluoride and Complete Protease Inhibitor cocktail (Roche Diagnostics). 2 µg of the extracted proteins were separated by SDS-PAGE gel and stained with CBB R-250 ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 mM DTT) supplemented with 0.3 mg.mL-1 lysozyme and EDTA-free protease inhibitor cocktail (Roche) prior to pressure-assisted lysis using a French press system ...
-
bioRxiv - Cell Biology 2022Quote: ... all sections were stained with DAPI (4′,6-Diamidine-2′-phenylindole dihydrochloride, #10236276001, Roche, 1:3000) to visualize cell nuclei within the aortic tissue ...
-
bioRxiv - Microbiology 2021Quote: ... and 100 U/mL human interleukin 2 (IL-2) (Roche) (Munoz et al. ...
-
bioRxiv - Microbiology 2021Quote: ... 2 M CaCl2 and 2 UU/ml DNAse I (Roche) for 30 min at 37°C ...
-
bioRxiv - Biophysics 2019Quote: ... and 30 IU/mL human interleukin-2 (hIL-2) (Roche).
-
bioRxiv - Biophysics 2021Quote: ... 2 mM MgCl2) supplemented with 2 protease inhibitor tablets (Roche), 1 mM PMSF ...
-
bioRxiv - Immunology 2023Quote: ... and 30 IU/mL human interleukin-2 (hIL-2) (Roche). To ectopically express Lifeact-eGFP or Lamp1-eGFP in CTLs ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were then incubated overnight at 4°C in primary antibody dilutions in freshly prepared BBT+ buffer (PBST + 1% BSA + 0.5 mM Spermidine + 2 mM EDTA + 1 large Roche complete EDTA-free tablets). Primary antibody was replaced with BBT+ buffer and quickly washed twice ...