Labshake search
Citations for Roche :
201 - 250 of 8337 citations for 7 Bromo 2 3 4 5 tetrahydro 1H benzo e 1 4 diazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... and incubated overnight at 4°C with Anti-Dig-AP antibody (Roche, 1:5000) in 1% lamb serum ...
-
bioRxiv - Immunology 2024Quote: ... beads and lysis buffer (20 mM Tris pH 7.4, 120 mM NaCl, 1 mM EDTA, 1% Triton-X-100, 0.5% sodium deoxycholate, 1× protease inhibitor cocktail [Roche])) ...
-
bioRxiv - Neuroscience 2020Quote: ... Supernatants from each buffer were dialyzed in 25 mM Tris-HCl and 5 mM EDTA pH 8.0 overnight at 4°C and subsequently digested with 200 mg/ml pronase (Roche). Peptides were precipitated with 5% trichloroacetic acid (TCA ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... lumbar vertebrae 1 – 5 were incubated in 2% Collagenase P (Roche, Switzerland) for 30 minutes at 30° C ...
-
bioRxiv - Biophysics 2019Quote: ... 4 mg/ ml Catalase (Roche, Cat#10106810001) and 1mM Trolox ((±)-6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid ...
-
bioRxiv - Cell Biology 2019Quote: ... 4 μl 5xTranscriptor RT reaction buffer (Roche), 0.5 μl RNase OUT (Fisher) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and DNase I (4 U/ml; Roche) in RPMI ...
-
bioRxiv - Plant Biology 2021Quote: ... 4 μl of PCR-grade water (Roche), 1 μl of the corresponding primer pair (10 μM each ...
-
bioRxiv - Neuroscience 2021Quote: ... 4°C) supplemented with protease (Roche, #11697498001) and phosphatase inhibitors (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... 4 μg/ml Laminin (Roche Basel, Switzerland), and 2 μg/ml Fibronectin (Sigma) ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 mM MgCl2, 0.5 mM β-mercaptoethanol, 1 mM ATP, 1% IGEPAL, 5% glycerol, 3 U/ml Benzonase and Roche Complete EDTA-free protease inhibitor ...
-
bioRxiv - Microbiology 2021Quote: ... Epidermal and dermal sheets were prepared after incubation overnight at 4°C with 4 U/ml dispase II (Roche) in PBS by gently separating dermis and epidermis each as intact sheets (Rahn et al. ...
-
Neurotransmission and neuromodulation systems in the learning and memory network of Octopus vulgarisbioRxiv - Neuroscience 2021Quote: ... Fluorescent counterstaining of cell nuclei was carried out in a PBS solution with 0.1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI; Roche Molecular Biochemicals ...
-
bioRxiv - Physiology 2020Quote: Islets were isolated from male C57BL/6 mice at 2 to 4 month of age using Collagenase P (Roche Diagnostics ...
-
bioRxiv - Molecular Biology 2023Quote: SDGC-SEC-purified stress granule cores (strain JD1370) were incubated at 0.23 A260 units/mL with 2 or 4 units of RNase H (10786357001; Roche) in 40 μL of RNase H buffer (20 mM HEPES-KOH pH 8.0 ...
-
bioRxiv - Cell Biology 2024Quote: ... After washes, the cells were stained with the DNA stain DAPI (4, 6 diamidino-2-phenylindole dihydrochloride) (Roche, #1023627001) and mounded with Prolong gold anti-fade mound media (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... 200 μM dNTPs (with 3:1 mix of 7-deaza-dGTP:dGTP; dNTPs from New England Bio Labs, cat#N0446, 7-deaza-2’-deoxy-GTP from Roche, cat#10988537001), 0.8 M Betaine (Alfa Aesar ...
-
bioRxiv - Cell Biology 2022Quote: ... Supernatants were diluted 1:4 with ice-cold dilution buffer (1× phos-stop [Roche], 0.5% NP-40, 1 mM DTT) and centrifuged again at 15,000 rpm for 15 minutes at 4°C to precipitate actomyosin components ...
-
bioRxiv - Cell Biology 2020Quote: ... They were allowed to equilibrate in rigor buffer (20 mM HEPES pH 7, 140 mM KCl, 2 mM MgCl2, 1 mM EGTA, 1 mM DTT, Roche complete protease inhibitor) over night at 4 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... This was spun down (5 minutes at 1800 RMP, 4°C) and the pellet then digested in 10ml collagenase/dispase (1mg/ml; Roche) and DNase I type IV (40µg/ml ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were incubated overnight at 4 °C with rat anti-HA antibody (1:500 - Roche) and then with secondary goat anti-rat IgG antibody coupled to Alexa 568 (Invitrogen/Life Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... incubated with anti-DIG-POD antibody (Roche; 1:1000 in TNB; 12 hr, 4 °C), and washed in TNT (3 × 20 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Sections were incubated overnight at 4°C with Anti-Digoxigenin-AP antibody (1:2000, Roche) in blocking solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... CD8 (clone SP57 at 1:7, Ventana- Roche), PD-1 (clone NAT105 ...
-
bioRxiv - Microbiology 2020Quote: ... and 3-4 mice/group subcutaneously received 25ng/g of pegylated-human interferon α (Peg-hIFNα-2a) (Hoffmann La Roche, Basel, Switzerland). To activate IFN-1 signaling ...
-
bioRxiv - Neuroscience 2022Quote: ... Cell pellets were homogenized in lysis buffer (7 M urea, 2 M thiourea, 1% CHAPS, 70 mM DTT, and Roche EDTA-free complete protease inhibitor cocktail ...
-
bioRxiv - Developmental Biology 2020Quote: ... supplemented with 4 ug/ml of insulin (Roche), 15 µg/ml transferrin (Roche) ...
-
bioRxiv - Neuroscience 2021Quote: ... incubated with 4 mg/ml Proteinase K (Roche) in PK buffer (100 mM Tris HCL pH7.5 ...
-
bioRxiv - Neuroscience 2021Quote: ... and Biotin-16-dUTP (Roche Diagnostics, 4 μm) and added to slides for 1 h at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 μg anti-HA antibody (Roche Sigma 11867423001) was used for immunoprecipitation with BioVision immunoprecipitation kit (K286-25) ...
-
bioRxiv - Neuroscience 2020Quote: ... and 4-nitro blue tetrazolium chloride (NBT) (Roche) overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 mM DTT and protease inhibitor cocktail (Roche)) to remove unbound protein ...
-
bioRxiv - Neuroscience 2019Quote: ... and BCIP 4-toluidine salt solution (Roche, 11383221001).
-
bioRxiv - Cancer Biology 2020Quote: ... containing DNase I (4 U/ml, #4716728001, Roche) at 37 °C for 45 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... and 4-nitro blue tetrazolium chloride (Roche Diagnostics) were used for detection ...
-
bioRxiv - Neuroscience 2023Quote: ... at 4°C with protease inhibitors cocktail (Roche). After 20 minutes centrifugation at 13000 g at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 mM MgCl2) supplemented with protease inhibitors (Roche cOmplete 1 tablet/10 mL ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 4 complete-EDTA protease-inhibitor tablets (Roche) per 500 mL ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 4 μg of DNase I (Roche, 104159) for incubation at 32°C for 15 min with shaking at 53 rpm ...
-
bioRxiv - Neuroscience 2023Quote: ... at 4°C with protease inhibitors cocktail (Roche). After 20 minutes of centrifugation at 13000 g at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... and phosphatase inhibitor (Roche; 4-906-837-001) on ice for 30 min ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...
-
bioRxiv - Developmental Biology 2019Quote: ... probes were synthesized at 37°C for 2-4 hrs in digoxigenin-synthesis reaction mixture with T3 RNA polymerase (Roche). After synthesis ...
-
bioRxiv - Biochemistry 2022Quote: ... were homogenized in 7x w/v homogenization buffer (320 mM sucrose, 4 mM HEPES–NaOH, 2 mM EDTA, and Complete protease inhibitor mix (Roche), pH 7.4 ...
-
bioRxiv - Microbiology 2022Quote: ... The plate was sealed and centrifuged (2 minutes, 180×g, 4°C) before analysis with the LightCycler 480 Instrument II (Roche; Preincubation ...