Labshake search
Citations for Roche :
501 - 550 of 7612 citations for 7 BROMO 1 2 3 4 TETRAHYDROCYCLOPENTA B INDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... 3 IU/mL erythropoietin (EPO; Roche), 50 ng/mL stem cell factor (SCF ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Cell Biology 2019Quote: ... ∼100 µl glass beads and 100 µl of lysis buffer (50 mM Tris-HCl pH 8.0, 1 mM EDTA, 15 mM Tris pH 9.5, 3 mM DTT, 1X cOmplete EDTA-free inhibitor cocktail [Roche]) were added to each dried pellet ...
-
bioRxiv - Cell Biology 2021Quote: ... The membranes were blocked with 3% skim milk in TBS for 30 minutes and then probed with mouse anti-GFP (1:1,000, Roche) or rabbit anti-aldolase (Mesén-Ramírez et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... 100 mM KCl, 1 mM MgCl2, 0.5 mM β-mercaptoethanol, 0.1 mM GTP, 3 U/ml benzonase, 1X Roche Complete EDTA-free protease inhibitor ...
-
bioRxiv - Cell Biology 2022Quote: ... and 100 µL protein breakage buffer (50 mM Tris-HCl pH 8.0, 1 mM EDTA, 20 mM Tris pH 9.5, 3 mM DTT, 1X cOmplete EDTA-free inhibitor cocktail [Roche]) were added to the samples ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected according to the manufacturer’s protocol at a µL lipofectamine: µg plasmid ratio of 3:1 (X-tremeGENE 9, Roche). After 48 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were first mechanically dissociated with a scalpel into approximately 1-3 mm pieces and enzymatically digested in RPMI-1640 medium (Cytiva) containing 0.25 mg/ml DNase I (Roche) and 0.25 mg/ml Collagenase (Sigma-Aldrich ...
-
bioRxiv - Physiology 2023Quote: ... or 50 Tris-HCl pH 7.5, 1 phenylmethylsulfonyl fluoride, 3% SDS (RyR, SERCA, CaMKIIδ-C273S) and supplemented with cOmplete protease inhibitor (Roche). Lysates were then incubated on ice for 15 min and centrifuged for 15 min at 15000 rcf at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... pellets were resuspended in 100 μl of lysis buffer (50 mM Tris, pH 7.5, 1 mM EDTA, 3 mM DTT, and 1X cOmplete protease inhibitor cocktail [11836145001, Roche]) and lysed on a beadbeater for 5 min at room temperature with 100 μl of acid-washed glass beads ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 mM magnesium chloride) supplemented with 1 cOmplete protease inhibitor cocktail tablet per 50 ml of lysis buffer (Roche) and mechanically disrupted in a Dounce homogenizer ...
-
bioRxiv - Cell Biology 2019Quote: ... 125 mM NaCl, 1% NP-40, 2 mM EDTA, 1 mM PMSF [Sigma, 93482-50ML-F], and protease inhibitor cocktail [Roche, 000000011836170001) and incubated on ice for 25 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 200 mM NaCl, 2 mM MgAc2, 1% [w/v] LMNG, 1 mM DTT, 1x complete EDTA-free protease inhibitor cocktail [Roche, Germany]). After 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... 200 mM NaCl; 2 mM MgAc; 1% [w/v] LMNG, 1 mM DTT, 1x complete EDTA-free protease inhibitor cocktail [Roche, Germany]) per 1 g of cell pellet and incubated for 30 min at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 mM NaCl, 2 mM MgCl2, 10 mM NaF, 1 mM PMSF, 1% Triton X-100 and Complete Protease inhibitor mixture, Roche Diagnostics) for 45 min on ice and centrifuged at 20000g for 10 min at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were then mechanically lysed (MagNAlyzer Roche – 6000 rpm, 1 min on, 2 min off) in the presence of 300 uL acid-washed glass beads (Sigma-Aldrich).
-
bioRxiv - Biochemistry 2021Quote: ... 1 mM Tris(2-carboxyethyl)phosphin (TCEP) with complete EDTA-free protease inhibitor cocktail (Roche) and 10 µg/ml DNAseI (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1 mM tris(2-carboxyethyl)phosphine [TCEP]) supplemented with EDTA-free protease inhibitors (Roche). The lysate was clarified by centrifugation (17,000 rpm for 1 h at 4°C ...
-
bioRxiv - Immunology 2020Quote: ... diluted 2-fold with PBMC culture media and supplemented with 10% WST-1 reagent (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM PMSF) supplemented with 1 protease inhibitor cocktail tablet (cOmplete-EDTA free, Roche, #11836170001) to a final volume of 50 mL ...
-
bioRxiv - Developmental Biology 2023Quote: ... was diluted 1 in 50 in solution consisting of 2 % blocking reagent (Roche ref 11096176001), 1 % goat serum (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... and then incubated overnight with primary antibody (monoclonal anti-FLAG, 1:1,000; Sigma-Aldrich, #F1804-1MG; or anti-GFP, 1:1000, Roche #11814460001 in 3% BSA/TBS-T) at 4°C ...
-
bioRxiv - Genomics 2021Quote: ... rp49 5’-TAATACGACTCACTATAGGGCAGTAAACGCGGTTCTGCATG-3’ and 5’-CAGCATACAGGCCCAAGATC-3’) were transcribed using the Biotin RNA Labeling Mix (Roche) and T7 polymerase (Promega).
-
bioRxiv - Neuroscience 2019Quote: ... Tongues were removed and an enzyme solution containing 0.7mg/mL Collagenase B (Roche, Basel, Switzerland), 3mg/mL Dispase II (Roche) ...
-
Reducing mitochondrial ribosomal gene expression does not alter metabolic health or lifespan in micebioRxiv - Cell Biology 2022Quote: ... 1.5mL per 0.5g tissue (4mg/mL dispase II [Sigma D4693], 10mg/mL collagenase B [Roche 11088831001] in Hams-F10 [Multicell ...
-
bioRxiv - Molecular Biology 2022Quote: ... Muscle tissues were minced and digested in type II collagenase and dispase B mixture (Roche). Digestion was neutralized by adding growth media containing F-10 Ham’s medium (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... containing 10 mg/ml of collagenase B and 2.4 U/ml Dispase II (Roche Diagnostics) for 30 min at 37°C under agitation and passed through a 30 μm cell strainer (Myltenyi Biotec) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The trypsin digestion was quenched by adding 4 μL of 1× EDTA-free protease inhibitor cocktail (Roche 11873580001). The supernatants were collected and the beads washed (50μL ...
-
bioRxiv - Neuroscience 2021Quote: ... participants were given either a total of 225mg of L-DOPA (Madopar, Roche, Levodopa/Benserazid, 4:1 ratio) or a placebo (P-Tabletten white 8mm Lichtenstein ...
-
bioRxiv - Immunology 2019Quote: ... pH 7.4, 150 mM NaCl, 0.25% deoxycholic acid, 1% NP-40 and 0.5% SDS supplemented with protease inhibitor [Roche]) and centrifuged at 12,000 g at 4°C for 10 min ...
-
bioRxiv - Zoology 2019Quote: ... After incubation at room temperature for 4 hours in 1:2000 dilution of anti-digoxigenin antibody (Roche #11376623) prepared in TBST containing 10% FBS ...
-
bioRxiv - Microbiology 2021Quote: ... The total qPCR reaction volume was 25 μl and consisted of 4 μl DNA (2,5 ng μl-1) and 12,5 μl LightCycler 480 SYBR Green I Master mix (Roche) containing 0.2 μM PCR primer (Table S5 ...
-
bioRxiv - Genetics 2022Quote: ... Overnight incubation with Anti-Dig antibody conjugated to alkaline phosphatase (1:5,000) at 4 °C (no. 11093274910; Roche) was followed by 8 × 30 min washing steps at room temperature with TBST 2 (TBST with 0.1% Tween 20 and 0.05% levamisole–tetramisole ...
-
bioRxiv - Immunology 2020Quote: ... 1 μM of each primer combination and 4 μL of Lightcycler FastStart DNA MasterPLUS SYBR Green I (Roche) in a total volume of 20 μL ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated overnight at 4 °C with alkaline phosphatase–conjugated anti-digoxigenin antibodies in TBTX (1:2000; Roche). Following extensive washing in TBTX ...
-
bioRxiv - Molecular Biology 2023Quote: ... Immunoprecipitation was performed at 4 °C for 1 h with pre-conjugated anti-HA affinity matrix (Roche 11815016001) or Anti-GFP Agarose (RQ2 ...
-
bioRxiv - Biochemistry 2023Quote: ... supplemented with DNAse I (4 U/ul) and 1 cOmpleteTM mini EDTA-free protease inhibitor cocktail tablet (Roche). The sample was lysed by French press at 17 KPsi (Constant Systems Ltd) ...
-
bioRxiv - Neuroscience 2023Quote: ... 4 % BSA in PBS) for 1 h at room temperature before being incubated with rat anti-HA (Roche) diluted either 1:250 (tsA-201cells ...
-
bioRxiv - Immunology 2023Quote: ... human interleukin-2 (IL-2) (10 IU/ml, Roche), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4-toluidine salt (BCIP, Roche) in NTMT buffer ...
-
bioRxiv - Microbiology 2023Quote: ... 4 U DNase I (Roche) with the reaction buffer provided with the enzyme for 20 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 mM MgCl2 (Roche Diagnostics), 0.3 µM of each primer (RB1_80F and RB1_235R ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 mM Tris-HCl (pH 7) and EDTA-free protease inhibitor cocktail (cOmplete™, Roche # 11873580001). After 30 min incubation on ice ...
-
bioRxiv - Genomics 2020Quote: ... 0.1% IGEPAL CA-630)7 supplemented with protease inhibitors (Complete Protease Inhibitor Cocktail, EDTA-free, Roche). Embryos were homogenized in a Dounce homogenizer then incubated in cold lysis buffer at 4°C for 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... and fractions 7–10 (cytosolic ribosomes) were pooled and treated with PCR grade proteinase K (Roche) in 1% SDS to release ribosome protected fragments ...
-
bioRxiv - Cancer Biology 2021Quote: ... were prepared using the IP buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1% TritonX-100, 0.5% Na-DOC, 1 mM EDTA, 2 mM PMSF and 1x Roche protease inhibitor cocktail). After sonification for 5 min and clarification with centrifuge at 16,000 g at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were stained with secondary antibodies (1:300) for 2 hours at room temperature and nuclei stained with DAPI (1:1000, Roche, Munich, Germany). The cells were mounted using the ProLong Diamond antifade mountant (Thermo ...
-
bioRxiv - Molecular Biology 2020Quote: ... plasmid DNA from the in vitro methylation reactions were transfected with 3 µL (Il33) or 1 µL (SV40) X-tremeGENE 9 transfection reagent (Roche) diluted in 50 µL of Opti-MEM medium (Gibco) ...
-
bioRxiv - Microbiology 2019Quote: ... The membranes were then probed for 16 h at 4 °C with the following primary antibodies in 3% (w/v) skim milk in PBS: mouse anti-GFP (1:1000, Roche), rabbit anti-SBP1 (1:1000 ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 mM sodium phosphate pH 8.0, 3% glycerol, 1% Triton X-100, 15 mM imidazole, and 1x protease inhibitor [Roche, Sigma]) and sonicated ...