Labshake search
Citations for Roche :
251 - 300 of 1597 citations for 7 Amino 1H benzimidazole 5 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 5% glycerol and protease inhibitor cocktail (Roche). The cell debris was removed from the lysate by centrifugation at 16,000 rpm for 30min ...
-
bioRxiv - Neuroscience 2020Quote: ... midazolam (5 mg/kg bodyweight; Dormicum, Roche), and medetomidine (0.5 mg/kg bodyweight ...
-
bioRxiv - Cell Biology 2021Quote: ... in 5 mg ml−1 dispase (Roche) and 0.1 mg ml−1 DNase I (Sigma ...
-
bioRxiv - Biophysics 2022Quote: ... and 5 μg of RNase A (Roche) per mg of cross-linked complex and incubated at 52 °C for 2 h ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 μl of SybrGreen master mix (Roche) and 1 μl of water were processed in a LightCycler® 480 instrument (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... 5% bovine serum albumin (BSA; #10735086001, Roche)] rotating overnight at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% bovine serum albumin (BSA; #10735086001, Roche)] rotating overnight at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% glycerol and 1x protease inhibitor (Roche)] ...
-
bioRxiv - Genetics 2024Quote: ... 5 μg/ml DNAse I (Roche 10104159001), and 0.05%Trypsin (Gibco 25200056 ...
-
bioRxiv - Cell Biology 2024Quote: ... and blocked in 5% BSA (Roche, 10735086001) in PBS solution ...
-
bioRxiv - Developmental Biology 2021Quote: ... and samples with RIN >7 were used for paired-end sequence library construction using the KAPA mRNA HyperPrep Kit (Roche # 08098123702). For ChIP samples ...
-
bioRxiv - Cell Biology 2022Quote: ... Two different HRMA-compatible platforms were used (Applied Biosystems ViiA 7 Real-Time PCR System, using the MeltDoctor HRM Master Mix, and Roche LightCycler 480 System ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: Total RNA was isolated at day 7 or 14 of MSCs differentiation using the High Pure RNA Isolation kit (Roche Diagnostics). For tissues ...
-
bioRxiv - Physiology 2021Quote: ... containing cOmplete EDTA-free protease inhibitor cocktail at a concentration of 1 tablet/7 ml (Roche Applied Science, Indianapolis, IN, USA)) by repeated passage through a 20-gauge needle to obtain plasma membrane-enriched preparations ...
-
bioRxiv - Microbiology 2023Quote: ... one half was immunoblotted with NB13 (7 µg/mL) followed by washing and probing with α-HA-peroxidase (1:1000, Roche), whereas the other half was probed with α-His-peroxidase only (1:4000 ...
-
bioRxiv - Biophysics 2023Quote: ... Cells were pelleted and resuspended in 50 mM Tris (pH 7) supplemented with 500 μg/mL lysozyme and 1x cOmplete EDTA-free protease inhibitor cocktail (Roche, 11873580001). The pellet was incubated at 4 ºC while rotating end over end for 45 min.
-
bioRxiv - Cancer Biology 2019Quote: ... the cell pellets were resuspended in lysis buffer (25 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 % NP-40, 5 mM MgCl2, 5 % glycerol and protease inhibitor cocktail [Roche]) and incubated for 20 min at 4 °C with end-over-end rotation ...
-
bioRxiv - Plant Biology 2020Quote: ... 150 mM NaCl, 5 mM EDTA, 5 mM EGTA, 0.1% Triton X-100, 1 mM PMSF, 1x protease inhibitor cocktail [Roche] ...
-
bioRxiv - Cell Biology 2021Quote: ... resuspended in 10 ml buffer A (50 mM Tris pH 7.5, 150 mM NaCl, 10% glycerol, 5 mM MgCl2, 5 mM ATP, Roche cOmplete EDTA-free protease inhibitor catalog # 11872580001) ...
-
bioRxiv - Microbiology 2019Quote: ... pH 7.4, 150 mM NaCl, 5 mM EDTA, 5% glycerol, 1% Triton X-100, and 1x complete protease inhibitor [Roche]). Cleared lysates were then incubated with glutathione sepharose (GE healthcare ...
-
bioRxiv - Neuroscience 2020Quote: ... Peels were cut in 2-5 mm2 pieces and placed in 5 ml digestion solution (0.75 mg/ml Liberase TH Research grade (Roche), 0.1 mg/ml DNAseI (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.25 μl forward (5 μM, IDT) and 0.25 μl reverse primer (5 μM, IDT) and was analysed on a LC480 instrument (Roche).
-
bioRxiv - Cancer Biology 2021Quote: ... 0.25 μl forward (5 μM, IDT) and 0.25 μl reverse primer (5 μM, IDT) and was analyzed on a LC480 instrument (Roche).
-
bioRxiv - Genetics 2021Quote: ... and the cell pellet resuspended in cold lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.5% NP-40, 1% Triton X-100, cOmplete protease inhibitor cocktail, Roche) and incubated on ice for 30 minutes ...
-
Species-specific protein-protein interactions govern the humanization of the 20S proteasome in yeastbioRxiv - Genetics 2022Quote: ... resuspended in 10 ml buffer A (50 mM Tris pH 7.5, 150 mM NaCl, 10% glycerol, 5 mM MgCl2, 5 mM ATP, Roche complete EDTA-free protease inhibitor ...
-
bioRxiv - Plant Biology 2023Quote: ... 5% glycerol, 50mM KCl, 5 mM EDTA, 0.1% Triton X-100, 5 mM DTT and 1 × protease inhibitor cocktail [Roche]). The homogenized lysates were incubated at 4 °C for 1 hour for western blot analysis of eIFiso4G1 or overnight for mass spectrometry analyses with 50 µl of prewashed immobilized γ-aminophenyl-m7GTP (C10-spacer)-agarose beads (Jena Bioscience) ...
-
bioRxiv - Microbiology 2023Quote: ... blocked in 5 % milk and probed with α-GFP (1:1,000 in 5 % milk; Roche Diagnostics GmbH, Mannheim, Germany), for GFP-based sensor probing ...
-
bioRxiv - Biochemistry 2023Quote: ... after removal of the medium cells were lysed in 1 mL of lysis buffer (50 mM Hepes [pH 8.0], 150 mM NaCl, 1 mM DTT, 5 mM MgCl2, 5 % Glycerol, supplemented with 0.55 % Nonidet P40 substitute [Roche] and cOmpleteTM EDTA-free Protease Inhibitor Cocktail [Roche]) ...
-
bioRxiv - Neuroscience 2021Quote: ... hydrated through an alcohol series and boiled in CC1 (citric acid buffer, Roche Diagnostics, Basel Switzerland) for 1 hour (pH 6 ...
-
bioRxiv - Genomics 2020Quote: ... concentrators and purified in large volume columns (High Pure Viral Nucleic Acid Large Volume Kit, Roche) using 10X (2.5 ml ...
-
bioRxiv - Microbiology 2019Quote: RNAs were re-extracted from the pig feces using High Pure Viral Nucleic Acid Kit (Roche), and cDNA was synthesized with random primers using SuperScript Ⅲ First-Strand Synthesis System (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... or the MagNA Pure LC Total Nucleic Acid Isolation Kit (Cat. 03038505001, Roche Diagnostic, Basel, Switzerland) following the manufacturer’s recommendations.
-
bioRxiv - Cell Biology 2021Quote: ... as described by (18)) with supplemented ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail tablets (Roche Diagnostics), 1 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Microbiology 2022Quote: ... Nucleic acid extraction was performed using the MagNA Pure Compact DNA Isolation Kit I (Roche Diagnostics) on the MagNA Pure LC automated extractor ...
-
bioRxiv - Developmental Biology 2019Quote: ... 1% deoxycholic acid and 1% Nonidet P-40 [NP-40]) containing protease inhibitor cocktail (Roche Diagnostics) and placed on ice for 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... Total nucleic acid was extracted from samples with the MagNA Pure 96 system (Hoffmann-La Roche) using the MagNA Pure 96 DNA and Viral NA Small Volume Kit and eluted in a volume of 50μl Roche Tris-HCl elution buffer ...
-
bioRxiv - Immunology 2020Quote: ... viral RNA was isolated from plasma using a MagNA PureCompact Nucleic Acid Isolation kit (Roche Diagnostics). Real-time RT-PCR was performed using a QuantiTec Probe RT-PCR kit (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... Viral DNA was then extracted using the High Pure Viral Nucleic Acid Kit (Roche Applied Science) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... 2% Triton X-100) containing ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail (Roche cOmplete, Sigma Aldrich)] ...
-
bioRxiv - Microbiology 2023Quote: Nucleic acids were purified from whole blood or serum using the MagNA Pure 96 system (Roche) with the DNA/Viral NA 2.0 kit and the Viral NA Plasma external lysis S.V ...
-
bioRxiv - Plant Biology 2021Quote: ... The sheared DNA fragments were end-repaired and deoxyadenosine-tailed in a 60 µL volume with 3 µL End Repair & A-Tailing Enzyme Mix and 7 µL End Repair & A-Tailing Buffer using a KAPA Hyper Prep Kit (KAPA Biosystems, USA) according to the manufacturer instructions (20°C 30 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Plant Biology 2020Quote: ... and proteins were extracted in protein extraction buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 % glycerol, 2 mM EDTA, 5 mM DTT, 1 × EDTA-free Complete Protease Inhibitor Cocktail [Roche, USA] ...
-
bioRxiv - Biochemistry 2022Quote: Trophozoite stage Hyp1-Nluc parasites at 1% parasitaemia were pelleted by centrifugation at 500g and lysed in 450x pellet volume hypotonic buffer (10 mM Tris-phosphate, 5 mM EDTA, 5 mM DTT, 1x complete protease inhibitor cocktail (Roche) pH 7.4 ...
-
bioRxiv - Immunology 2022Quote: ... Tissue pieces then were transferred to a 50-mL conical tube containing 5 ml of digestion medium #2 (RPMI without phenol red containing 5% of FCS, 25 µg/ml of Liberase (Roche), and 200 µg/ml of DNase I (Sigma)) ...
-
bioRxiv - Systems Biology 2019Quote: ... 1 mM EDTA) supplemented with phosphatase inhibitors (5 mM b-glycerophosphate, 5 mM NaF, 1 mM Na3VO4 and protease inhibitors (Roche cOmplete ULTRA Tablets ...
-
bioRxiv - Neuroscience 2019Quote: ... Striatum and ventral midbrain from injected and non-injected hemispheres were rapidly dissected and homogenized with 6 volumes of Triton lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 5% glycerol, 1% Triton-X100, 1 mM EDTA, 1X EDTA-free Complete protease inhibitor cocktail [Roche] and 1X phosphatase inhibitor cocktail 2 and 3 [Sigma]) ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Physiology 2021Quote: ... cDNA was diluted 1:10 or 1:5 and 5 μl or 2 μl was used with the Light Cycler Syber Green master mix (Roche), or AMPLIFY ME SG Universal Mix (Blirt) ...