Labshake search
Citations for Roche :
51 - 100 of 991 citations for 7 8 dimethylbenzo c acridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and phenol (phenol-Tris saturated, pH 8; Roche, Indianapolis, IN) and chloroform:isoamyl alcohol (American Bioanalytical ...
-
bioRxiv - Biochemistry 2022Quote: ... pH=8) supplemented with EDTA-free protease inhibitor mixture (Roche) and 100 mM PMSF ...
-
bioRxiv - Microbiology 2023Quote: ... and suspended in 8 M urea containing PhosSTOP (Roche Diagnostics) and Benzonase (Novagen) ...
-
bioRxiv - Biophysics 2023Quote: Microchambers were incubated with 8 mg/µl anti-digoxigenin (Roche) at 25°C for 90 min and then the blocking buffer (PBS with 1% α-casein ...
-
bioRxiv - Biophysics 2021Quote: ... Anti-c-Myc (Roche) molecules were covalently linked to the carboxylated polystyrene beads (Spherotech ...
-
bioRxiv - Molecular Biology 2021Quote: ... or Glu-C (Roche) at 25 °C for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Mitomycin C (Merck (Roche), 10107409001) ...
-
bioRxiv - Microbiology 2024Quote: ... mitomycin C (Roche Diagnostics) as prophage-inducing reagent [73] was added in triplicates in different final concentrations ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reverse transcription products were then amplified by quantitative PCR (95 °C, 5 minutes; 95 °C, 15 seconds; 60 °C, 60 seconds; 40 cycles) (LightCycler® 480, Roche) using TaqMan Universal PCR Master Mix and specific probes for miRNAs ...
-
bioRxiv - Immunology 2023Quote: 7-plex IF panel was created using the Ventana BenchMark Ultra (Roche Diagnostics) automated staining platform ...
-
bioRxiv - Bioengineering 2019Quote: ... Fluorescence scanning was performed from 25°C- 95°C at a rate of 1°C/min using a Lightcycler 480 Instrument (Roche Life Scientific). Melting temperatures were calculated from the inflection point in the first-derivative curve.
-
bioRxiv - Neuroscience 2021Quote: ... Nematodes were resuspended in 8 M urea in 100 mM TRIS-HCl buffer (pH 8) containing cOmplete™ protease inhibitor cocktails (Roche Diagnostic Canada, Laval, QC, Canada) and aliquoted into reinforced 1.5 mL homogenizer tubes containing 500 μm glass bead homogenizer tubes with 25 mg of glass beads ...
-
bioRxiv - Cancer Biology 2021Quote: ... 20mM Tris-HCl pH 8) supplemented with protease inhibitors (Roche, 04693116001), followed by a final washing step with TE 1X buffer ...
-
bioRxiv - Biochemistry 2019Quote: ... pH 8) containing complete protease inhibitor (in 50ml) cocktail (Roche Molecular) and disintegrated with a French press (1100 psi) ...
-
bioRxiv - Cell Biology 2020Quote: ... the specimen was digested in 8 mg/mL Collagenase D (Roche) and 4.8 U/mL Dispase II (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 8] with EDTA-free Protease Inhibitor Cocktail (Roche, Basel, Switzerland) and were clarified by centrifugation ...
-
bioRxiv - Molecular Biology 2019Quote: ... all at pH 8) supplemented with a phosphatase (Roche, Basel, Switzerland) and protease inhibitor cocktail (Roche) ...
-
bioRxiv - Neuroscience 2019Quote: ... 8 U/ml RNAse inhibitor and a protease inhibitor cocktail (Roche). Cell debris and nuclei were removed by centrifugation at 1000 g for 10 min at 4°C yielding pellet P1 and supernatant S1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... pH 8 with added inhibitors (cOMPLETE™ tablets, EDTA-free, Roche), DNAse (1 mg/ml) ...
-
bioRxiv - Cancer Biology 2019Quote: ... with filters (8-μm pore size) pre-coated with fibronectin (Roche). APOC2 overexpressing cells ...
-
bioRxiv - Neuroscience 2021Quote: ... 20 mM Tris HCl pH 8 with protease inhibitor cocktail (Roche) and assayed for protein concentration by the BCA assay (Pierce) ...
-
bioRxiv - Biophysics 2023Quote: ... pH 8) with cOmplete EDTA-free protease inhibitor cocktail (11873580001, Roche), 70 µg/mL lysozyme (90082 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The samples were immunostained for Ki67 (clone 30-9 at 1:7, Ventana- Roche), CD8 (clone SP57 at 1:7 ...
-
bioRxiv - Plant Biology 2019Quote: ... The proteins were then subsequently digested at 37°C with Lys-C (Roche Applied Science) during 4 h then with trypsin (Sequencing Grade Modified ...
-
bioRxiv - Genomics 2020Quote: ... Muscles were digested with 8 mg/ml Collagenase D (Roche, Basel, Switzerland) and 10 U/ml Dispase II (Roche ...
-
An optimized ChIP-Seq framework for profiling of histone modifications in Chromochloris zofingiensisbioRxiv - Genomics 2021Quote: ... The ligated products were enriched with 8 cycles of PCR (KAPA biosystems) and size selected to 200-500 bp with Total Pure NGS beads (Omega Bio-tek) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 8 M Urea loading dye was supplemented with complete protease inhibitor (Roche). 100 μl Urea loading dye were used to resuspend cell pellet after NaOH treatment ...
-
bioRxiv - Cancer Biology 2023Quote: ... 50mM Tris-HCl (pH 8) + protease inhibitor cocktail (PIC, cOmplete Mini, Roche)] and sonicated under optimized conditions that yielded an average DNA length of ∼300 bp ...
-
bioRxiv - Systems Biology 2023Quote: ... Muscles were digested with 8 mg/ml Collagenase D (Roche, Basel, Switzerland) and 10 U/ml Dispase II (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 mM Tris pH 8 in water) with Protease inhibitors (Roche, 11836170001). WCL lysate was incubated on ice for 30 min and centrifuged at max speed for 10 min to remove debris ...
-
bioRxiv - Molecular Biology 2023Quote: ... pH 8) supplemented with cOmplete™ EDTA-free protease inhibitor tablets (Roche) and Benzonase® nuclease ...
-
Dysregulated expanded endocannabinoid system as therapeutic targets of amyotrophic lateral sclerosisbioRxiv - Neuroscience 2024Quote: Cell viability assays were performed using a WST-8 kit (Roche Diagnostics) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... 8 M Urea and 1x cOmpleteTM EDTA-free protease inhibitor (Roche #11873580001). Lysates were sonicated with a probe sonicator and cleared via centrifugation at 15,000x g for 30 min ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Cell Biology 2019Quote: ... Mitomycin C was from Roche (USA). Poly-L-lysine was from Sigma (USA ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-c-myc (9E10 clone, Roche), anti-Flag (M2 ...
-
bioRxiv - Genetics 2019Quote: ... c-myc (Roche, 11667149001; 1:500), HA (Sigma ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 mM EDTA pH 8) in presence of Complete Protease Inhibitor Cocktail (Roche) and Halt Phosphatase Inhibitor Cocktail (Pierce) ...
-
bioRxiv - Biochemistry 2021Quote: ... pH 8) containing one tablet of cOmplete EDTA-free Protease Inhibitor Cocktail (Roche). Cells were lysed via two passages through a French pressure cell at 1,500 psi ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the remaining 21865 reads (∼8 Mb) were submitted for assembly by Newbler (Roche). Of the 6309 obtained contigs (N50 = 663 bp) ...
-
bioRxiv - Microbiology 2021Quote: ... pH 8 (buffer A) supplemented with EDTA free complete protease inhibitor tablets (Roche). The cells were lysed using a French press at 18000 psi ...
-
bioRxiv - Cell Biology 2022Quote: Conjugation of protein or nanobody was performed with an 8-fold (Laminin; Roche) or 4-fold (R2-myc-his ...
-
bioRxiv - Genetics 2023Quote: ... with 6-8 cycles of PCR amplification using KAPA-HiFi (Kapa Biosystems, KK2602). DNA library was sequenced using an Illumina NextSeq 500 75-cycle high output kit.
-
bioRxiv - Cell Biology 2021Quote: ... 20 mM Tris-HCl (pH 7) and EDTA-free protease inhibitor cocktail (cOmplete™, Roche # 11873580001). After 30 min incubation on ice ...
-
bioRxiv - Genomics 2020Quote: ... 0.1% IGEPAL CA-630)7 supplemented with protease inhibitors (Complete Protease Inhibitor Cocktail, EDTA-free, Roche). Embryos were homogenized in a Dounce homogenizer then incubated in cold lysis buffer at 4°C for 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... and fractions 7–10 (cytosolic ribosomes) were pooled and treated with PCR grade proteinase K (Roche) in 1% SDS to release ribosome protected fragments ...
-
bioRxiv - Pathology 2020Quote: C-reactive protein was measured using the Tina-quant C-Reactive Protein Gen.3 reagent (Roche, Basel, Switzerland) designed to achieve very high sensitivity ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5 µg poly[d(I-C)] (Roche) competitor DNA ...
-
bioRxiv - Biochemistry 2022Quote: ... and digested with endoproteinase Lys-C (Roche) followed by modified trypsin (Promega) ...
-
bioRxiv - Neuroscience 2021Quote: ... 4°C) supplemented with protease (Roche, #11697498001) and phosphatase inhibitors (Roche ...