Labshake search
Citations for Roche :
51 - 100 of 402 citations for 7 12 Dioxa spiro 5.6 dodec 9 ene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... pX330-based plasmids were transfected using X-tremeGENE-9 (Roche) together with a mCherry-expressing plasmid ...
-
bioRxiv - Cell Biology 2022Quote: ... containing AAVS1-targeting recombination arms [62] using XtremeGene 9 (Roche). Transfected cells were allowed to recover for 48 hrs before treatment with 1 μg/ml puromycin (Sigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... 24 h) using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 0.4 µg vsFULL envelope plasmid using Xtremegene-9 (Roche). After 16 hours ...
-
bioRxiv - Cell Biology 2024Quote: ... media containing 24 μL of X-tremeGENE 9 DNA (Roche) and added to HEK cells ...
-
bioRxiv - Cell Biology 2022Quote: Cells were transfected using X-tremeGENE 9 DNA Transfection Reagent (Roche). To generate retroviral particles ...
-
Pancreatic progenitor epigenome maps prioritize type 2 diabetes risk genes with roles in developmentbioRxiv - Genomics 2020Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche). 24 hours later ...
-
bioRxiv - Genomics 2020Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche), and 24 hours later 8000 GFP+ cells were sorted into a well of six-well plate ...
-
bioRxiv - Genomics 2019Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche). 24 hours later ...
-
bioRxiv - Biophysics 2021Quote: ... and cells were transfected using the Xtreme-Gene 9 reagent (Roche) according to the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA transfection reagent (Roche), with 1.2 µl X-tremeGENE reagent per 500 µg DNA reaction ...
-
bioRxiv - Cancer Biology 2022Quote: ... using X-treme GENE 9 DNA transfection reagent (Roche, XTG9-RO) to produce the lentiviral particles ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... X-tremeGENE™ 9 DNA Transfection Reagent was bought from Roche Pharma (Reinach ...
-
bioRxiv - Cancer Biology 2020Quote: ... R26ERG organoids with X-tremeGENE™ 9 transfection reagent (Roche, 6365779001). After 2 days ...
-
bioRxiv - Neuroscience 2023Quote: ... Transient transfection was carried out using X-tremeGENETM 9 reagent (Roche) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Cell Biology 2022Quote: ... 2013) and were transfected using XtremeGENE 9 DNA Transfection reagent (Roche) at a concentration of 200 ng/ml (unless otherwise stated ...
-
bioRxiv - Microbiology 2024Quote: ... The X-treme Gene 9 (X9) DNA transfection reagent (Roche: 6365809001) was added 1:3 as DNA:X9 added to the plasmid dilution and mixed properly ...
-
bioRxiv - Systems Biology 2024Quote: ... The library was amplified for 9 cycles with Kapa polymerase (Roche) using the oligonucleotides 5’ tagtggtagaaccaccgcttgtc and 5’ actttttcaagttgataacggactagcc and assembled into pCRISPRpp linearized by BbvCI digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with DNA using Xtreme-GENE 9 DNA (Roche) or with TransIT-HeLaMonster (Mirus ...
-
bioRxiv - Cell Biology 2019Quote: ... 7 μg/ml transferrin (Cat.# 652202, Roche) and 150 units penicillin/streptomycin (Cat.#15140) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 7 μl proteinase inhibitor 7X (Roche, 04693159001) and 5 μl phosphatase inhibitor 10X (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... and 0.025% pronase (Roche, 7 U/mg)] in complete DMEM/F-12 medium in a spinner flask ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TP53 (DO-7) (platform Ventana, Roche).
-
bioRxiv - Developmental Biology 2023Quote: ... or fluorescein-12-UTP (Roche) using standard molecular protocols (Collins et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... DNA transfection was performed using X-tremeGENETM 9 DNA transfection reagent (Roche) in OptiMEM media according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... The transfection was performed using X-tremeGENE 9 DNA transfection reagent (Roche) according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral helpers and constructs were transfected using X-tremeGENE 9™ (Roche) according to the manufacturer’s instructions at a 1:3 ratio ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche, 6365787001), and 24 h later 5000 GFP+ cells were sorted into a well of six-well plate using mTeSR1 medium supplemented with 10 µM Y-27632 ...
-
bioRxiv - Cell Biology 2020Quote: ... Transfections were performed using the X-tremeGENE 9 Transfection Reagent kit (Roche) to introduce 1-2 μg of plasmid DNA as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: Plasmid transfections were performed using X-tremeGENE 9 DNA transfection agent (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... plasmids were transfected using X-tremeGENE 9 DNA transfection reagent (Roche, 6365787001) following the manufacturer’s protocol (1 μg plasmid ...
-
bioRxiv - Physiology 2022Quote: ... 150 ng of each plasmid were transfected with X-tremeGENE 9 (Roche) in C2C12 myoblasts immediately after trypsinization (47) ...
-
bioRxiv - Cell Biology 2023Quote: The TetR-eYFP tagged proteins were transfected using the XtremeGene-9 (Roche) transfection reagent according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... RPE1 cells were transfected using X-tremeGENE 9 DNA Transfection Reagent (Roche) according to the manufacturer’s directions ...
-
bioRxiv - Cell Biology 2024Quote: ... two steps of transfections were performed: DNA using XtremeGENE™ 9 (Roche) followed by siRNA (4392420-s30722 ...
-
bioRxiv - Genetics 2024Quote: ... and viral envelope vector gag-pol using XtremeGene 9 transfection reagent (Roche). Collection of viral particles and transduction was performed as described for lentiviral particles ...
-
bioRxiv - Immunology 2024Quote: ... catalog number 2708) using the X-tremeGENE 9 DNA Transfection Reagent (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Transfections were performed using X-tremeGENE 9 DNA transfection agent (Roche Diagnostics). Full-length human TREK-1(TREK-1 FL ...
-
bioRxiv - Biochemistry 2020Quote: ... COS-7 cells were transfected using FuGENE6 (Roche) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... CD8 (clone SP57 at 1:7, Ventana- Roche), PD-1 (clone NAT105 ...
-
bioRxiv - Microbiology 2023Quote: ... 7 μM KAPA Unique Dual-Indexed (UDI, Roche) adapters were ligated to the second strand synthesis product in the presence of a ligation master mix in a reaction that was performed at 20 °C for 15 min ...
-
bioRxiv - Biophysics 2023Quote: ... and 7 U/mL DNase I (04536282001, Roche). Cells were lysed and the lysate clarified as above ...
-
bioRxiv - Biophysics 2023Quote: ... and 7 U/mL DNase I (04536282001, Roche). The resuspended cells were rotated end-over-end for 30 min at 4 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... 7 µM KAPA-single index adapters (Roche, KK8700d) were added to A-tailed cDNA ...
-
bioRxiv - Neuroscience 2021Quote: ... fluorescein-12-UTP (FITC, Roche Diagnostics), or digoxigenin-11-UTP (DIG ...
-
bioRxiv - Molecular Biology 2023Quote: ... and dithiothreitol (Roche, 3483-12-3). Lysates were rocked at 4C for 20 min and centrifuged 10 min at 15,000g ...
-
bioRxiv - Cancer Biology 2021Quote: ... 200 μM dNTPs (with 3:1 mix of 7-deaza-dGTP:dGTP; dNTPs from New England Bio Labs, cat#N0446, 7-deaza-2’-deoxy-GTP from Roche, cat#10988537001), 0.8 M Betaine (Alfa Aesar ...
-
bioRxiv - Biochemistry 2020Quote: ... Transient transfection of cells was performed with the X-tremeGENE 9 reagent (Roche) or polyethylenimine (PEI ...