Labshake search
Citations for Roche :
451 - 500 of 1954 citations for 7 Diethylamino 3 2 thienyl coumarin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Neuroscience 2021Quote: ... at the ratio of 1:3 using X-tremeGENE HP DNA Transfection Reagent (Roche) following the manufacturer’s recommended protocol ...
-
bioRxiv - Immunology 2022Quote: ... containing 3 mL of RPMI media with 70 μg / mL of Liberase TM (Roche) and 30 μg / mL of Dnase I (Roche) ...
-
bioRxiv - Immunology 2019Quote: Mouse lungs were homogenized in HEPES buffer with Liberase Blendzyme 3 (70ug/ml; Roche) and DNaseI (30ug/ml ...
-
bioRxiv - Genomics 2021Quote: Probes 1-3 were labelled with digoxigenin-11-dUTP or biotin-11-dUTP (Roche) using BioPrime® Array CGH ...
-
bioRxiv - Biophysics 2020Quote: ... The oocytes were treated with collagenase A (3 mg/ml; Roche (Grenzach-Wyhlen, Germany)) for 105 min in Ca2+-free Barth’s solution containing (in mM ...
-
bioRxiv - Plant Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3’end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was completed with 3% BSA protease free (Roche Ref# 03 117 332 001) for 1 hour at RT ...
-
bioRxiv - Developmental Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). 10 picomols of each probe were used for each slide ...
-
bioRxiv - Immunology 2023Quote: ... minced with razor blade and digested enzymatically with 3 mg/mL collagenase/dispase (Roche) at 37 °C for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Physiology 2023Quote: ... and 0.165 mg/mL BCIP (5-Bromo-4-chloro-3-indolyl phosphate, Roche, 11383221001) in alkaline phosphatase buffer ...
-
bioRxiv - Genetics 2023Quote: ... Bound protein/protein complexes were washed 3 times ((1x TBS, 0.5% Nonident P40 (Roche), 1% phosphatase inhibitor cocktail 2 and 3 (Sigma)) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Immunology 2023Quote: ... containing 3 mL of RPMI media with 70 µg / mL of Liberase TM (Roche) and 30 µg / mL of DNase I (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... the cell samples were incubated with 300 nM DAPI (Cat# 28718-90-3, Roche) in PBS for 15 min and washed three times with PBS ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 400nM 5-Bromo-4-chloro-3-indolyl phosphate p-toluidine salt (BCIP, Roche).
-
bioRxiv - Microbiology 2024Quote: ... and specific primers (Table 3) on the LightCycler 480 Real-Time PCR System (Roche). Fold change was calculated using the comparative 2-ΔΔCt method ...
-
bioRxiv - Immunology 2021Quote: The measurement of anti SARS-CoV-2 neutralizing Abs was performed by electrochemiluminescence sandwich immunoassay (ECLIA) through Roche Elecsys Anti-SARS-CoV-2 S (Roche diagnostics, Switzerland). The neutralizing Ab were measured on a Cobas 601 modular analyzer (Roche diagnostics ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% sodium deoxycholate, 50 mM NaF, 2 mM EDTA, 2 mM DTT, 0.2 mM Na orthovanadate, 1 X Roche protease inhibitor #11836170001). Lysates were sonicated and centrifuged to remove debris ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ATP regeneration system (2 mM ATP, 2 mM phosphoenolpyruvate [PEP, Sigma-Aldrich, #P7127], 0.4 mM NADH [Roche, 10107735001], 1.67% (v/v) pyruvate kinase/lactate dehydrogenase mix [PK/LDH ...
-
bioRxiv - Cell Biology 2023Quote: ... UGGT2-/- and UGGT1/2-/-cells were transfected with 1 µg Trop-2-pEYFP-N1 or Trop-2-Q118E-pEYFP-N1 plasmids using X-tremeGENE 9 DNA transfection reagent (Roche, Basel, Switzerland) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM EDTA and cOmplete mini-protease inhibitor (Roche)) mixed for 25 minutes at 4 °C to ensure complete lysis ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1x FastStart PCR Buffer including 2 μM MgCl2 (Roche), 0.05 mm dNTPs (Roche) ...
-
bioRxiv - Cancer Biology 2019Quote: ... containing DNase I (2 U/ml, Roche, Pleasanton, CA) in Roswell Park Memorial Institute (RPMI)-1640 medium supplemented with 5% FBS (VWR Life Science Seradigm ...
-
bioRxiv - Neuroscience 2021Quote: ... Slides were preincubated in 2% blocking reagent (Roche, 11096176001) in MABT (100mM Maleic Acid ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mM EDTA) with protease inhibitors (cOmplete Mini, Roche). Lysates were resolved on SDS-PAGE gels (Novex Tris-Glycine ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 200 U/ml of IL-2 (Roche) and 50 U/ml of penicillin/streptomycin (Gibco) ...
-
bioRxiv - Zoology 2021Quote: ... 12.5 μl of 2× KAPA HiFi HotStart ReadyMix (Roche), 10 μl of 1μM forward and reverse primers and 2.5 μl of template DNA (5–20 ng/μl ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2 mM MgCl2 with Protease Inhibitor Cocktail (Roche) and clarified by centrifugation ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM benzamidine and a protease inhibitor cocktail (Roche), and cleared by centrifugation ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 mM 2-mercaptoethanol and protease inhibitor cocktail (Roche). The samples were centrifuged at 16,000g for 45 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 mM 1,10-phenanthroline) containing protease inhibitor (Roche,#4693159001). The homogenates were centrifuged at 100,000 g ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 200 U/ml of IL-2 (Roche) and 50 U/ml of penicillin/streptomycin (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... with 100 μl DNase I (2 mg/ml, Roche) in a 37 °C incubator shaking orbitally for 30 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 2 mg/mL protease inhibitor mixture (Roche Diagnostics)) ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 μL of 25× protease inhibitor cocktail (Roche, #4693159001), 1 μL of 50 mM biotin ...
-
bioRxiv - Cell Biology 2022Quote: ... and 2 mg/ml protease inhibitor mixture (Roche Diagnostics) and samples prepared ...
-
bioRxiv - Microbiology 2020Quote: ... and recombinant interleukin-2 (20U/ml; Hoffmann-La Roche). Fresh medium containing IL-2 was added twice per week ...
-
bioRxiv - Immunology 2019Quote: ... rhIL-2 (200 U mL−1; Roche Applied Science) and rhTGF-β1 (1 ng mL−1) ...
-
bioRxiv - Cell Biology 2021Quote: ... and protease inhibitors (2 complete EDTA-free pellets (Roche)/50 ml buffer ...
-
bioRxiv - Developmental Biology 2020Quote: ... blocked in blocking buffer with 2% Blocking Reagent (Roche), 20% goat serum in MABT ...
-
bioRxiv - Developmental Biology 2019Quote: ... 2 mM EDTA) containing Complete Protease inhibitor Cocktail (Roche) and Phosphatase inhibitor Cocktail 3 (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 mM PMSF and phosphatase inhibitor cocktail (PhosSTOP; Roche). For the analysis of RAN translation after cellular stress induction ...
-
PSGL-1 inhibits HIV-1 infection by restricting actin dynamics and sequestering HIV envelope proteinsbioRxiv - Microbiology 2020Quote: ... and human recombinant IL-2 (30 U/ml, Roche) for 72 h.
-
bioRxiv - Microbiology 2022Quote: ... using 2× Lightcycler 480 probes master (Roche, Indianapolis, IN) for IPO8 and Maxima SYBR Green/ROX qPCR Master Mix (2X ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 mM DTT and 1 × cOmplete protease inhibitors (Roche) and sonicated for 15 minutes total time (10s on/20s off ...