Labshake search
Citations for Roche :
451 - 500 of 8621 citations for 7 3S 5S 3 Amino 5 methyl 1 piperidinyl 1 cyclopropyl 1 4 dihydro 8 methoxy 4 oxo 3 quinolinecarboxylic acid with 2 hydroxybutanedioic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... and 0.1% deoxycholic acid with protease inhibitors (Roche). The lysates were subjected to anti-GFP immunoprecipitation using GFP- Trap beads (ChromoTek) ...
-
bioRxiv - Microbiology 2023Quote: ... or High Pure Viral Nucleic Acid kit (Roche) kits ...
-
bioRxiv - Molecular Biology 2024Quote: ... Ethylenediamine tetraacetic acid -free protease inhibitor cocktail (Roche) was added fresh to the binding buffer ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μl of pyrophosphatase at 5 μg/ml (Roche), 4 μl of 1 mg/mL T7 RNA polymerase and 20 μl of transcription buffer 5X (Hepes pH7.5 400 mM ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 mM KCl) with 1% protease inhibitor cocktail (Roche), 1% phosphatase inhibitor cocktail (Roche ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1% deoxycholate) and 5% protease inhibitor cocktail (Roche, Germany). Whole cell extracts were incubated at 4°C for 30 min on a shaker ...
-
bioRxiv - Genomics 2023Quote: ... protease inhibitors (1 tablet per 5 mL, Roche 4693159001)) was added to the embryo pellet ...
-
bioRxiv - Immunology 2023Quote: ... Following antibodies were diluted in 1-5% BSA (Roche): anti-cGAS (Cell Signaling ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 5 mM type 1 collagen (Roche Diagnostics) to allow spheroid formation and seeded onto the ULA plates at a concentration of 5 × 103 cells per well ...
-
bioRxiv - Immunology 2023Quote: ... 3 mM ATP (Roche), 25 μg/ml MSU (InvivoGen) ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Microbiology 2022Quote: ... 0.2 μL of each primer (100mM stock) (Table SI-4) and 5 μL of 2× KAPA SYBR Fast Universal qPCR kit (KAPA Biosystems, USA). Samples were cycled (40 cycles ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were counterstained with 4’,6-Diamidine-2’-phenylindole-dihydrochloride (DAPI; Roche).
-
bioRxiv - Molecular Biology 2023Quote: ... nuclei were stained using 4’,6-diamidino-2-phenylindole (DAPI, Roche Diagnostics) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... 1% SDS, 1 mM EDTA, 1 mM DTT, 1 mM Na3VO4×2H2O, 5 µM pepstatin A, 10 µM leupeptin, 2X Roche protease inhibitor cocktail), 200µl glass beads were added ...
-
bioRxiv - Plant Biology 2023Quote: ... pH 7.5, 150 mM NaCl, 1 mM EDTA, 10 % [v/v] glycerol, 1 mM DTT, and 1 × complete Protease Inhibitor [Roche; Cat. No. 058929700001]) was added to homogenised plant material (100 μl extraction buffer per 100 mg plant material) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Blocking of membranes was carried out in buffer 2 (buffer 1 plus 1% blocking reagent (Roche)) for 30 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5% Normal Goat Serum) for 3 h at room temperature and then incubated overnight with alkaline phosphatase-conjugated anti-DIG Fab fragments (Roche, 1: 2,000) at 4°C on a shaking platform ...
-
bioRxiv - Neuroscience 2020Quote: ... 1996) on 16 µm cryosections at post-natal day 3 (P3) using anti-digoxigenin antibody (Sheep polyclonal, 1:1000, Roche, 11093274910, RRID:AB_514497). Two days exposure to alkaline phosphatase (AP ...
-
bioRxiv - Physiology 2021Quote: ... a 6.7 kb DNA fragment starting 1 kb upstream of murine Gnrhr exon 3 was amplified by PCR using the Expand Long Template PCR System (Roche, Basel, Switzerland) from 129SvEv genomic DNA using primers incorporating 5’ XmaI and 3’ NotI restriction enzyme sites (Table 1) ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cells were lysed in 50 µl of lysis buffer (10 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% NP-40, 1× Roche Complete protease inhibitors cocktail) by pipetting up and down ...
-
bioRxiv - Microbiology 2022Quote: ... Beads were then washed three times with 400 μL wash buffer (25 mM Tris-HCl pH 8, 150 mM NaCl, 1 mM EDTA pH 8, cOmplete protease inhibitor cocktail (Roche), 5% glycerol) ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were collected via centrifugation and lysed in lysis buffer (1.5M KCl, 20 mM Tris pH 8.0, 20 mM Imidazole pH 8, 1 mM DTT, 1 tablet of Roche protease inhibitor cocktail). Sonication was performed to further lyse cells and to shear DNA ...
-
bioRxiv - Plant Biology 2021Quote: ... The resulting nuclear pellet was resuspended in wash buffer (10 mM Tris pH 8, 0.25 M sucrose, 10 mM MgCl2, 1 mM EDTA, 1% Triton X-100, 1X Roche protease inhibitor cocktail) and nuclei were cleaned and pelleted at 12,000 x g for 10 min at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein was extracted using NETN buffer (20 mM Tris-HCl pH 8, 420 mM NaCl, 1 mM EDTA, 0.5% IGEPAL, 1 mM DTT, and Roche Protease Inhibitor Cocktail) and were resolved in 8% Bis-Tris SDS-PAGE gels ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM EDTA pH 8 and 10 mM NaF completed with 1 × protease inhibitor cocktail (Pierce, #A32955) and 1 × phosphatase inhibitor cocktail (Roche PhosSTOP, #490684001). The total protein concentration was determined using Bradford assay (Protein Assay Reagent ...
-
bioRxiv - Microbiology 2021Quote: ... samples were enzymatically analyzed using a D-Lactic Acid/L-Lactic Acid Enzymatic Bioanalysis UV-Test kit and a D-Glucose Enzymatic Bioanalysis UV-Test kit (Roche Diagnostics) with a modified manufacturer’s protocol to reduce total sample size to 300 uL ...
-
bioRxiv - Microbiology 2019Quote: Viral nucleic acid was extracted from 200µl of the filtrate using the High Pure viral nucleic acid kit (Roche Diagnostics, USA) following the standard protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... pH 7.5, 150 mM NaCl, 5 mM EDTA, 2 mM ATP, 1 mM dithiothreitol and protease inhibitor cocktail tablets; Roche) using Bead Beater ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR analysis was performed by mixing 5 μL of 1 μmol·L-1 of both primers and 2.5 μL of 0.25 ng·μL-1 template DNA with 12.5 μL 2× KAPA HiFi HotStart ReadyMix (Roche, Basel, Switzerland). The thermal program was 98°C for 3 min ...
-
bioRxiv - Neuroscience 2024Quote: ... and BCIP (5-bromo-4-chloro-30-indoly phosphate p-toluidine salt, Roche). After development ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% sodium deoxycholate, 50 mM NaF, 2 mM EDTA, 2 mM DTT, 0.2 mM Na orthovanadate, 1 X Roche protease inhibitor #11836170001). Lysates were sonicated and centrifuged to remove debris ...
-
bioRxiv - Neuroscience 2024Quote: ... resuspended in 150 μL buffer C (50 mM Tris pH 8, 5 mM EDTA, 1% SDS, 100 mM NaCl, 1x Roche complete mini protease inhibitors) and incubated on ice for 10 min ...
-
bioRxiv - Immunology 2019Quote: ... rhIL-2 (200 U mL−1; Roche Applied Science) and rhTGF-β1 (1 ng mL−1) ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 mM DTT and 1 × cOmplete protease inhibitors (Roche) and sonicated for 15 minutes total time (10s on/20s off ...
-
bioRxiv - Biophysics 2020Quote: ... the same procedure was used using different lysis (50 mM HEPES pH 7.4, 100 mM NaCl, 10% glycerol, 1 mM DTT, 1 mM ATP, 2 mM PMSF, 1 Roche tablet per 50 mL) and storage (50 mM Tris pH 7.4 ...
-
bioRxiv - Developmental Biology 2022Quote: LC-MS-based quantification of methyl-cytosines was performed on 1 μg of DNA degraded to nucleosides with nuclease P1 (Roche), snake venom phosphodiesterase (Worthington ...
-
bioRxiv - Neuroscience 2021Quote: ... Pooled tissue from each brain region was suspended in 6 ml of 0.32 M sucrose homogenization buffer (4 mM HEPES, 0.1 mM CaCl2, 1 mM MgCl2, plus Roche protease inhibitor tablet) and homogenized with a Teflon homogenizer using 10 strokes at 900 rpm ...
-
bioRxiv - Plant Biology 2021Quote: ... The digested DNA was separated in a 1 % agarose gel at 50 Volts for 72 hours at 4°C and transferred to a nylon membrane (Roche®) overnight ...
-
bioRxiv - Biophysics 2022Quote: ... embryos were washed (4 X 10 min) in PBTx and blocked in PBT-B (1× PBS, 20% (v/v) western blocking reagent (Roche, 11921673001), 2 mM ribonucleoside vanadyl complex (NEB ...
-
bioRxiv - Pathology 2020Quote: ... Coverslips were incubated overnight at 4 °C with a 1:100 dilution with one of the following primary antibodies: HA (Roche, #867423001), KDEL (Abcam ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... for 3-4 hours at room temperature followed by overnight incubation at 4°C in anti-DIG-AP Fab fragments (1:5000) (Roche 1093274). Embryos were washed with PBST followed by an alkaline tris buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... The supernatant was then discarded and the pellet was resuspended in 300 µL SDS buffer (4 % SDS, 10 mM EDTA, 25 mM TrisHCl pH 7.5, 1 mM PMSF, 1x Roche protease inhibitor) and incubated at room temp (10 minutes) ...
-
bioRxiv - Cell Biology 2022Quote: ... for 2 hours at room temperature and incubated with an appropriate antibody overnight at 4°C: 1:3000 anti-DIG-AP (Roche 11093274910), 1:1000 anti-DIG-POD (Roche 11207733910 ...
-
bioRxiv - Cancer Biology 2022Quote: Engineered monoallelic cell pellets (500 million cells/sample) were lysed at 4°C in 1% CHAPS (Roche Diagnostics, cat no. 10810126001) lysis buffer (pH 8.0 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were then incubated overnight at 4°C with a 1:2000 dilution of alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche #11093274910) in MABT blocking buffer with 1% sheep serum ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were then incubated overnight at 4°C with a 1:2000 dilution of alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche #11093274910) in MABT blocking buffer with 1% sheep serum ...
-
bioRxiv - Neuroscience 2023Quote: ... tissue sections (3-5μm) from frontal cortex (BA 8/9) using the Nexes station automated system (Ventana Medical System Inc., Roche). Deparaffinised and rehydrated sections were pretreated and blocked ...
-
bioRxiv - Immunology 2022Quote: ... was added and cells were centrifuged at 350g for 7 min at 4°C and resuspended in PBS with 0.5% BSA (Roche) and 1% FBS (Sorting Buffer) ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 % SDS and 5 mM EDTA) supplemented with 1x complete protease inhibitor cocktail (Roche, Switzerland) and 1 mM phenylmethylsulfonyl fluoride ...