Labshake search
Citations for Roche :
451 - 500 of 2680 citations for 6 methyl 3 oxo 2 3 dihydropyridazine 4 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... tissue sections (3-5μm) from frontal cortex (BA 8/9) using the Nexes station automated system (Ventana Medical System Inc., Roche). Deparaffinised and rehydrated sections were pretreated and blocked ...
-
bioRxiv - Neuroscience 2024Quote: ... Ganglia were then treated for 20 min at 37°C with 3 mg/ml collagenase (type I; Roche Diagnostics) and 3 mg/ml dispase II (Roche Diagnostics ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 mM magnesium chloride) supplemented with 1 cOmplete protease inhibitor cocktail tablet per 50 ml of lysis buffer (Roche) and mechanically disrupted in a Dounce homogenizer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cells were then washed with PBS 3 times and lysed with RIPA buffer supplemented with protease inhibitor cocktail (Roche), 0.1% Benzonase (Millipore-Sigma) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the “tracrRNA U6.3 promoter” fragment was amplified with left (AAGATATCCGGGTGAACTTCGN19GTTTTAGAGCTAGAAATAGC) and right (GCTATTTCTAGCTCTAAAACN19CGACGTTAAATTGAAAATAGG) sgRNA primers from pUC 3GLA U6.1/3 sgRNA using Pwo polymerase (Roche) with initial 30 sec denaturation at 94°C followed by two cycles 94°C/30 sec ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 µg of plasmid was used for transient transfection using X-tremeGENE™ HP DNA Transfection Reagentreagent (Roche, 6366236001) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: We used DOTAP (N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl-sulfate) (Roche) to introduce LPS or oxPLs into cells following the method by Zanoni et al (Zanoni et al. ...
-
bioRxiv - Microbiology 2021Quote: ... HEK293T cells were cotransfected with 4 μg of Env-deficient HIV-1 proviral plasmid (Q23ΔEnvGFP) and 2 μg of HIV-1 Env clone of interest using Fugene 6 transfection reagent (Roche) following manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... expanded to passage 4 and transfected with RCAS-PDGFB-HA or RCAS-shp53-RFP using a Fugene 6 Transfection kit (Roche, 11814443001). Cells were cultured with DMEM media (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: ... L6 cells and cardiomyocytes by incubating them in their respective media containing 2% (w/v) fatty acid-free bovine serum albumin (FAF-BSA; Roche) and 0.4 mM sodium palmitate (Sigma ...
-
bioRxiv - Neuroscience 2021Quote: ... medium was replaced with E6 medium (DMEM/F-12 supplemented with 64 mg/L L-ascorbic acid 2-phosphate magnesium, 14 µg/L sodium selenium, 543 mg/L sodium bicarbonate, mg/L insulin [Roche, Penzberg ...
-
bioRxiv - Cell Biology 2023Quote: ... embryos were incubated for 1 hour in TBST and then in Blocking Buffer (2% blocking reagent in maleic acid buffer pH 7.5 (Roche, #11096176001) and 10% sheep serum (Sigma Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... Control siRNA (qiagen) and CXCR4 siRNA (SMARTPool, Dharmarcon) were diluted in DOTAP (1,2-dioleoyl-3-trimethylammonium-propane; Roche Applied Sciences). The mix was gently mixed and incubated at room temperature for 15 min ...
-
bioRxiv - Developmental Biology 2021Quote: Tissue samples were minced into small pieces (1-3 mm3) using a scalpel and dissociated with collagenase/dispase (1 mg mL-1; COLLDISP-RO, Roche) in the presence of Rock inhibitor (RI ...
-
bioRxiv - Molecular Biology 2022Quote: In vitro transcribed RNA was prepared from linearized plasmid containing the human PTH 3’-UTR (68) using a Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase ...
-
bioRxiv - Molecular Biology 2020Quote: ... were generated by transfection of 3×FLAG-tagged LRRK2 (WT) plasmid followed by pharmacological selection using an antibiotic G-418 (Roche). Transfection of plasmids and siRNA was performed using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... samples were incubated with 27 µl labeling solution plus 3 µl enzyme solution (In Situ Cell Death Detection Kit, AP, Roche) at 37°C overnight ...
-
bioRxiv - Physiology 2019Quote: ... for 45 seconds at 6,000 rpm x 3 (5 minutes on ice in between intervals) using a Roche Magnalyser instrument (Roche, Germany) and homogenization tubes containing ceramic beads (MagNA Lyser Green Beads ...
-
bioRxiv - Microbiology 2019Quote: ... small pieces of cryotissue were homogenized 3 times for 30s at 6500rpm using the MagNALyzer ® instrument (Roche Molecular Systems) with buffer RTL and β-mercaptoethanol (according to the manufacturer’s instructions) ...
-
bioRxiv - Systems Biology 2019Quote: ... 25ml of pre-warmed to 37°C EGTA buffer followed by 25ml of pre-warmed to 37°C EBS buffer with 2.3U of Liberase Blendzyme 3 recombinant collagenase (Roche Diagnostics) were cannulated into the vena cava ...
-
bioRxiv - Molecular Biology 2020Quote: ... plasmid DNA from the in vitro methylation reactions were transfected with 3 µL (Il33) or 1 µL (SV40) X-tremeGENE 9 transfection reagent (Roche) diluted in 50 µL of Opti-MEM medium (Gibco) ...
-
bioRxiv - Microbiology 2019Quote: ... The membranes were then probed for 16 h at 4 °C with the following primary antibodies in 3% (w/v) skim milk in PBS: mouse anti-GFP (1:1000, Roche), rabbit anti-SBP1 (1:1000 ...
-
bioRxiv - Microbiology 2019Quote: ... The cytotoxic potential of the samples was determined from THP1-cell supernatants after 3 hours by using the Cytotoxicity Detection Kit (Roche) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2019Quote: ... lungs were removed and single-cell suspensions of lung mononuclear cells were prepared by Liberase Blendzyme 3 (70 ug/ml, Roche) digestion containing DNaseI (30 µg/ml ...
-
bioRxiv - Biochemistry 2020Quote: ... The thorax and the abdomen were then washed with 3 ml of pre-chilled 0.1 M KBP pH 7.4 homogenization buffer (HB) containing 1x protease inhibitor (Roche Complete ULTR). The complex was homogenized in 20 ml of HB using 40 ml glass Dounce homogenizer with a loose B pestle (Wheaton Science ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 mM sodium phosphate pH 8.0, 3% glycerol, 1% Triton X-100, 15 mM imidazole, and 1x protease inhibitor [Roche, Sigma]) and sonicated ...
-
bioRxiv - Genomics 2020Quote: ... 60 μl of anti-mouse magnetic beads were washed PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche) or Anti-Rpb3 antibodies (Neoclone ...
-
Programmed ER fragmentation drives selective ER inheritance and degradation in budding yeast meiosisbioRxiv - Cell Biology 2021Quote: ... Pellets were resuspended by bead beating for 5 min in 100 μL TE supplemented with 3 mM and 1x protease inhibitors (Roche) with 100 μL acid-washed glass beads ...
-
bioRxiv - Molecular Biology 2021Quote: Aag2 cells were transfected with a plasmid expressing 3×flag tagged Zuc using X-tremeGENE HP DNA Transfection Reagent (Roche), and fixed 48 hours after transfection ...
-
bioRxiv - Molecular Biology 2021Quote: A 3×flag tagged Zuc expression plasmid was transfected into Aag2 cells using X-tremeGENE HP DNA Transfection Reagent (Roche). Cells were lysed and lysates incubated with M2-Flag beads (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: Sense and anti-sense DIG-labelled RNA probes were synthesised from 5’ and 3’ regions of tert using DIG RNA Labelling Mix (Roche). A 562bp 3’ region of tert ...
-
bioRxiv - Neuroscience 2022Quote: Mounted coronal cryosections were rinsed in PBS for 3 times (5 min) and thereafter incubated in Blocking Reagent (Roche Diagnostics) for 15 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... after lysis of the insect cell pellet by 3 cycles of freeze-thaw in the presence of Complete protease inhibitor cocktail (Roche), and removal of debris the lysate was loaded onto a 20-40% sucrose density gradient ...
-
bioRxiv - Neuroscience 2021Quote: ... and PI) and de-glycosylated for 3 h at 37 °C with 1 unit of PNGase-F (Roche Applied Science) added per 10 μl volume ...
-
bioRxiv - Genomics 2019Quote: ... The dry contents were resuspended by addition of 7.5 µl hybridization buffer and 3 µl hybridization component A (SeqCap EZ Hybridization and Wash Kit: 05 634 261 001, Roche), mixed by tapping ...
-
bioRxiv - Genetics 2019Quote: ... located in exon 18 and reverse primer 5’-TTGGTGGCTACAAAGACGTG-3’ located in exon 22 using the One Tube reverse transcription-PCR reaction kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: BAL was performed by cannulation of the trachea and gentle instillation/aspiration (3 times) of 1.0 ml PBS with 0.1% BSA and protease inhibitor cocktail tablets (Roche, Indianapolis, IN). Animals were then perfused with PBS before tissue collection ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 pmol of the forward and reverse gene-specific primers each (Supplemental Table 3) in Light Cycler SYBR Green I Master mix (Roche) on LightCycler 480 II (Roche) ...
-
bioRxiv - Cell Biology 2019Quote: ... Real-time quantitative PCR reactions from 8,3 ng of cDNA were set up in triplicate using a LightCycler DNA SYBR Green I Master PCR machine (Roche). The oligonucleotides used in qRT-PCR experiments are provided in SI6.
-
bioRxiv - Physiology 2019Quote: ... Cartilages from two hips of one mouse were pooled together and washed 3 times in PBS with protease (Roche 11836170001) and phosphatase inhibitors (Sigma P0044 and P5726 ...
-
bioRxiv - Developmental Biology 2021Quote: Genomic DNA was extracted from 3 week old tail or ear biopsies using KAPA Mouse DNA Extraction Kit (KAPA Biosystems) or High Pure PCR Template Kit (Roche).
-
bioRxiv - Cancer Biology 2020Quote: ... Exon 1 and exon 3 digestion products were purified using the High pure PCR product purification kit (Roche, Basel, Switzerland) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... 2.5 mL of Sf9 cells at a density of 1.2×106 cells/mL were transfected with 5 µL of recombinant bacmid containing the gene of interest using 3 µL of X-tremeGENE HP DNA transfection reagent (Roche) and 100 µL of transfection medium (Expression Systems) ...
-
bioRxiv - Biophysics 2019Quote: ... The central fragment of the molecule is flanked by oligonucleotides labelled either with digoxigenin (3’ end) or biotin (5’ end) that specifically bind either to a glass surface covered with Anti-digoxigenin (Roche) or to superparamagnetic beads (MyOne ...
-
bioRxiv - Immunology 2020Quote: ... or S-Fusion + N-ETSD constructs were cultured and transfected as described in the main manuscript and harvested 3 days after transfection in 150 mL RIPA lysis buffer with 1X final Protease Inhibitor cocktail (Roche). After protein assay ...
-
bioRxiv - Immunology 2021Quote: ... and 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) (pH 8.0) and the presence of Complete® protease inhibitor (Roche). The preparation was centrifuged for 10 min at 2500 rpm and 4 °C and supernatant was transferred to a new tube and centrifuged for 40 min at 30,000 x g and 4 °C ...
-
bioRxiv - Immunology 2020Quote: ... Cyclophilin B (control) and PPARγ siRNA (SMARTPool, Dharmarcon) were diluted in DOTAP (1,2-dioleoyl-3-trimethylammonium-propane; Roche Applied Sciences). The mix was gently mixed and incubated at room temperature for 15 min ...
-
bioRxiv - Cell Biology 2021Quote: ... The cell pellets were thawed on ice and lysed (3 freeze thaw cycles) after re-suspending each one in 100 μl of PBS containing protease inhibitors (Roche), 0.8 % NP40 ...
-
bioRxiv - Cell Biology 2021Quote: ... The lymphocytes from the immunized mice were fused with myeloma P3U1 cells at a ratio of 3:1 by mixing in 50% polyethylene glycol (Roche). The fused cells were dispersed in 80 ml of GIT medium (Wako ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were washed 3 times with 10 ml of ice-cold PBS supplemented with Complete Protease Inhibitor (Roche, Basel, Switzerland) and cells were resuspended in 1 ml of ice-cold PBS supplemented with Complete Protease Inhibitor ...