Labshake search
Citations for Roche :
651 - 700 of 1544 citations for 6 fluoro 5 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... determined as the amount of 5-bromo-2′-deoxy-uridine (BrdU) incorporation (Roche BrDU Labeling and Detection Kit II ...
-
bioRxiv - Genetics 2023Quote: ... 5 mM Tris-HCl (pH 7.4) supplemented with Protease Inhibitor cocktail (Roche, #04693159001) and transferred to a 7 mL Dounce tissue grinder (KIMBLE KONTES ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... After 3 minutes 10 μL of 5 mg/mL Liberase (Roche, cat # 05401119001) were added ...
-
bioRxiv - Developmental Biology 2023Quote: ... using a 5 μl reaction mixture of DNA SYBR Green I Master (Roche) according to the standard manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 35 mg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, Roche). The reaction was stopped with PBS and the sections were mounted in Glycergel (Dako) ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mM beta-mercaptoethanol (BME)) with cOmplete EDTA-free Protease Inhibitor Cocktail (Roche). After lysate centrifugation at 48.384g for 45 min at 4°C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The cell proliferation ELISA BrdU (5′-bromo-2′-deoxyuridine) colorimetric assay (Roche,11647229001) was performed as per the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: ... then 5 min at 62°C) with KAPA HiFi HotStart Ready Mix (Roche). Libraries were quantified by Bioanalyzer (Agilent ...
-
bioRxiv - Biochemistry 2023Quote: ... 5% glycerol) containing a protease inhibitor cocktail tablet (Complete EDTA-free, Roche Diagnostics) and gently stirred for 30 min in the presence of 0.2 mg/mL lysozyme (Sigma Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... 5% glycerol) supplemented with Complete Mini protease inhibitor mixture tablet (Roche Applied Science) and 10 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Genetics 2023Quote: ... Each reaction consisted of 5 μL LightCycler 480 SYBR Green Master mix (Roche), 0.5 μL each of the forward and reverse primers (100 μM ...
-
bioRxiv - Neuroscience 2024Quote: ... pH 7.6 with KOH) containing 5 mg ml−1 collagenase (type A, ROCHE). Defolliculated oocytes were injected with 50 ng mRNAs of mixed GlyT1 ...
-
bioRxiv - Neuroscience 2024Quote: ... and BCIP (5-bromo-4-chloro-30-indoly phosphate p-toluidine salt, Roche). After development ...
-
bioRxiv - Immunology 2024Quote: ... Cell nuclei were stained with 5 µg/ml of DAPI (10236276001, Roche Diagnostics).
-
bioRxiv - Immunology 2023Quote: ... 5 mM EDTA] supplemented with 1x protease inhibitors (Mini Protease Inhibitor Tablets, Roche). Total protein concentration was determined by BSA Protein Assay Kit (Thermo Life) ...
-
bioRxiv - Genomics 2020Quote: ... 2 g of DUX4 expression constructs were transfected into RD cells with 6 L of the X-treme GENE 9 DNA transfection reagent (cat. XTG9-RO, Roche Diagnostics, Indianapolis, USA) diluted in 100 L of Opti-MEM I (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... and 5 µg of a WEAU gp160 plasmid (pcDNA3.1-WEAU gp160) into exponentially dividing 293T/17 cells using FuGENE 6 (Roche Applied Science, Indianapolis, IN) or into 293F cells using 293fectin (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tissues were washed and the secondary antibodies applied (dilutions listed below) with 4′-6-diamidino-2-phenylindole (DAPI: Cat # 10-236-276-001, Roche Diagnostics, Indianapolis, IN) at 1:1,000 for 1 hour ...
-
bioRxiv - Cancer Biology 2023Quote: ... Dynamic monitoring of cell growth was determined every 12 hours during 6 days using the impedance-based xCELLigence system (Roche Applied Science, Germany). The cell index was derived from measured cell-electrode impedance that correlates with the number of viable cells.
-
bioRxiv - Cancer Biology 2021Quote: ... proliferation was measured using 5-bromo-2’-deoxy-uridine (BrdU) labelling (Roche, Basel, Switzerland). Cells were pulsed with 10μM BrdU ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 mM sodium ortho vanadate (Na3VO4) and protease inhibitor cocktail (Roche cat. no. 04693124001) and phosphatase inhibitor (Roche cat ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 mM sodium ortho vanadate (Na3VO4) and Protease Inhibitor cocktail (Roche Cat. No. 04693124001) and Phosphatase inhibitor (Roche Cat ...
-
bioRxiv - Neuroscience 2021Quote: Zebra finches received intramuscular (I.M.) injections of 2-Bromo-5’-deoxyuridine (BrdU; Roche Diagnostics) in 0.05 M tris buffered saline (TBS ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5% glycerol with protease inhibitors (Roche, 1 tablet per 10 mL lysis buffer). Worm slurry was frozen in liquid nitrogen and stored at -80 °C until lysis ...
-
bioRxiv - Molecular Biology 2021Quote: ... in an IP buffer (1xPBS, 5% glycerol, 0.5 mM EDTA, 1mM PMSF, 1x Roche cOmplete™Protease Inhibitor Cocktail ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 mM sodium ortho vanadate (Na3VO4) and Protease Inhibitor cocktail (Roche Cat. No. 04693124001) and Phosphatase inhibitor (Roche Cat ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 cOmpleteTM mini EDTA-free protease inhibitor cocktail tab per 5 ml (Roche, 0463159001), 40 U RNaseOUTTM (Thermo Fisher 10777019 ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 μl of KAPA SYBR Fast RT-qPCR solution (Kapa Biosystems, Inc., Woburn, MA), 0.5 μl of 10 μM forward and reverse primers ...
-
bioRxiv - Genetics 2021Quote: ... followed by addition of 5 µl of 4 µg/mL DNase-free RNase (Roche). Samples were loaded onto 96-well Qiacube-HT® columns and DNA was purified using a Blood & Tissue kit (Qiagen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The supernatant was incubated at 55 °C overnight with 5 µL proteinase K (Roche). Genomic DNA was extracted with phenol:chloroform extraction.
-
bioRxiv - Plant Biology 2021Quote: ... Amplification involved cDNA (2 μl, 5 ng/μl) in optical 384-well plates (Roche Light Cycler 480 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and supplemented with 5 mM CaCl2 and 15 units of S7 micrococcal nuclease (Roche). Lysates were sonicated for 10 seconds at low power followed by incubation on ice for 30 minutes and clarification by centrifugation at 13,000 x g for 15 minutes at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... 5 hours incubation in MTSB containing 2 % BSA containing either an anti-GFP (Roche) or an anti-PIN1 monoclonal antibody at 0.1 % ...
-
bioRxiv - Plant Biology 2021Quote: ... in a total volume of 5 µL and analyzed on a Lightcycler 480 (Roche). Each reaction was done in three technical and three biological repeats ...
-
bioRxiv - Microbiology 2021Quote: ... Western-blot antibody detection was used using antibodies from Roche Diagnostics Mannheim Germany (Anti-HA, mouse monoclonal primary antibody (12CA5 Roche, 5 mg/ml) at a dilution of 1:1000 ...
-
bioRxiv - Physiology 2021Quote: ... 5 mM sodium ortho vanadate (Na3VO4) and Protease Inhibitor cocktail (Roche Cat. No. 04693124001) and Phosphatase inhibitor (Roche Cat ...
-
bioRxiv - Cell Biology 2021Quote: Using serum-free media supplemented with 5 g/l BSA fraction V (Roche, #107351080001), islets were pre-treated with 100 nM CCK ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 mM β-mercaptoethanol and the EDTA-free complete ULTRA protease inhibitor cocktail (Roche). Proteins were batch-purified using Ni-NTA agarose resin (Macherey-Nagel ...
-
bioRxiv - Immunology 2022Quote: ... Mouse tail epidermis was separated from dermis by 5 mg/ml Dispase II (Roche) digestion in 37°C for 1 hr ...
-
bioRxiv - Plant Biology 2021Quote: ... 300 nM gene-specific primers and 5 µL SYBR Green Mix (Roche, Mannheim, Germany). Amplification was done using StepOneTM Real-Time PCR System according to the manufacturer’s description (Applied Biosystems ...
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were stained with 5 mg/ml 41,6-diamidino-2-phenylindole (DAPI; Roche, 1023627600) in PBS for 1 min and coverslips were mounted onto SuperFrost® Plus slides (R ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... supplemented with 5 mM DTT and a protease inhibitor cocktail (Complete EDTA-free, Roche). Spores were transferred to tubes containing Lysing Matrix E (MP Bio) ...
-
bioRxiv - Microbiology 2019Quote: ... 5 μg of total RNA were treated with recombinant DNase I (Roche Diagnostics Ltd.) at 37°C for 30 min and then purified using a standard phenol–chloroform method ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5% glycerol) supplemented with protease and phosphatase inhibitors (1X EDTA-Free inhibitor cocktail (Roche), 1 mM PMSF ...
-
bioRxiv - Physiology 2020Quote: ... 5 mM sodium ortho vanadate (Na3VO4) and Protease Inhibitor cocktail (Roche Cat. No. 04693124001) and Phosphatase inhibitor (Roche Cat ...
-
bioRxiv - Immunology 2019Quote: ... 150 mM NaCl] containing 5 mM EDTA and Complete EDTA-free protease inhibitor (Roche)) ...
-
bioRxiv - Biochemistry 2020Quote: ... 1% NP-40 and 5% glycerol) supplemented with protease inhibitors (Roche Complete EDTA-free). Protein concentrations were determined by bicinchoninic acid assay (BCA protein assay kit ...
-
bioRxiv - Developmental Biology 2020Quote: ... DNA from lysed cells was removed using 5 μl RNAse-free DNAse I (Roche) for every 1 ml dissociate and incubated at 37°C for 5 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM EDTA and EDTA-free Protease Inhibitor Cocktail tablets (Roche AG, Basel, Switzerland). Cell debris was removed by centrifugation (4 °C) ...