Labshake search
Citations for Roche :
601 - 650 of 3220 citations for 6 cyano 5 methoxy 12 methylindolo 2 3 a carbazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 2 mg/mL BSA (Roche), 60 µg/mL catalase (Sigma) ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 mM creatine phosphate (Roche), 10 µg/ml creatine kinase (Roche) ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 mM GTPgS (Roche, 10220647001) and 4 mM MgCl2 in BRB80 was incubated for 5 hours at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 protease inhibitor tablets (Roche), 20 M MG132 (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2023Quote: ... in 2% Blocking Reagent (Roche) and 5% sheep serum (Sigma ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 PhosSTOP easy Pack (ROCHE), Protease Inhibitor cocktail (Sigma) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µg BSA (Roche Diagnostics) and 1 U Immolase DNA polymerase (Meridian Bioscience ...
-
bioRxiv - Genomics 2022Quote: ... a PCR was performed with primers containing NGS sequences (KAPA HiFi HotStart ReadyMix, Kapa Biosystems, 12 cycles), and the library was cleaned using 0.8x SPRI beads.
-
bioRxiv - Microbiology 2019Quote: ... Purified parasites treated at 12°C for 1 h with freshly prepared 1 mg/mL pronase (Roche)/0.01% saponin/PBS before washing ...
-
bioRxiv - Genomics 2022Quote: ... PCR amplification with 9 – 12 cycles using the KAPA HiFi HotStart Uracil + DNA Polymerase (Roche/KAPA Biosystems) was performed according to suggested protocols ...
-
bioRxiv - Genomics 2022Quote: ... PCR amplification with 9 – 12 cycles using the KAPA HiFi HotStart Uracil + DNA Polymerase (Roche/KAPA Biosystems) was performed according to suggested protocols ...
-
bioRxiv - Genetics 2023Quote: ... 1 Complete EDTA-free Protease Inhibitor cocktail tablet per 12 mL lysis buffer (Roche Applied Science, #1873580)] and drop frozen in liquid nitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... whole transcriptome amplification by PCR was performed for 12 cycles using KAPA HiFi HotStart ReadyMix (Roche, 7958935001) with a PCR primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 3 μL of Proteinase K (20 mg/mL) (Roche Diagnostics Australia Pty ...
-
bioRxiv - Cancer Biology 2020Quote: ... Endogenous peroxidase activity was quenched in 3% hydrogen peroxide (Roche) in PBS for 15 minutes ...
-
bioRxiv - Biochemistry 2022Quote: ... followed by collagenase D (3 mg/mL, COLLD-RO, Roche) two times at 37 degrees ...
-
bioRxiv - Genomics 2022Quote: ... and 3 μL of Proteinase K (20 mg/mL) (Roche Diagnostics Australia Pty ...
-
bioRxiv - Genetics 2019Quote: ... and 3 μL of Proteinase K (20 mg/ mL) (Roche Diagnostics Australia Pty ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 3 μL of Proteinase K (20 mg/mL) (Roche Diagnostics Australia Pty ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 3 mL of proteinase K (20 mg/mL) (Roche Diagnostics Australia Pty ...
-
bioRxiv - Developmental Biology 2023Quote: Dissected embryos were incubated with a liberase-blendzyme 3 (Roche) solution for 90min at 33 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 3% bovine serum albumin (Roche Diagnostics, Meylan, France) and 1.3 mg/ml collagenase A (Merck ...
-
bioRxiv - Molecular Biology 2019Quote: ... 25 mM Tris-HCl pH 7.4, 5 mM EDTA, 5 mM MgCl2, 1% NP-40, 0.5 mM DTT, Roche mini-tablet protease inhibitor ...
-
bioRxiv - Immunology 2020Quote: Isolated B cells from Gal9KO mice were lysed in NP40 lysis buffer (50 mM HEPES pH 8.0, 150 mM NaCl, 5 mM dithiothreitol, 5 mM EDTA, 0.1% Nonidet-P40, Roche cOmplete mini EDTA-free protease inhibitor ...
-
bioRxiv - Biochemistry 2021Quote: ... and 2 μL of each sample was used for qPCR with 2 × Sybr Green (Roche) and primers for human RPLP2 (housekeeping gene) ...
-
bioRxiv - Microbiology 2022Quote: ... (2) the quantitative Roche Spike Elecsys Anti-SARS-Cov-2 S assay (Roche, IND, USA), which measures spike total antibody concentrations ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 mM NaF and protease inhibitors (Roche)] ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 5 μL/mL NBT (Roche, 11383213001), was then added and slides were placed at 37°C to allow colour to develop ...
-
bioRxiv - Cell Biology 2021Quote: ... 5% glycerol and protease inhibitor cocktail (Roche). The cell debris was removed from the lysate by centrifugation at 16,000 rpm for 30min ...
-
bioRxiv - Neuroscience 2020Quote: ... midazolam (5 mg/kg bodyweight; Dormicum, Roche), and medetomidine (0.5 mg/kg bodyweight ...
-
bioRxiv - Cell Biology 2021Quote: ... in 5 mg ml−1 dispase (Roche) and 0.1 mg ml−1 DNase I (Sigma ...
-
bioRxiv - Biophysics 2022Quote: ... and 5 μg of RNase A (Roche) per mg of cross-linked complex and incubated at 52 °C for 2 h ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 μl of SybrGreen master mix (Roche) and 1 μl of water were processed in a LightCycler® 480 instrument (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... 5% bovine serum albumin (BSA; #10735086001, Roche)] rotating overnight at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% bovine serum albumin (BSA; #10735086001, Roche)] rotating overnight at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% glycerol and 1x protease inhibitor (Roche)] ...
-
bioRxiv - Genetics 2024Quote: ... 5 μg/ml DNAse I (Roche 10104159001), and 0.05%Trypsin (Gibco 25200056 ...
-
bioRxiv - Cell Biology 2024Quote: ... and blocked in 5% BSA (Roche, 10735086001) in PBS solution ...
-
bioRxiv - Developmental Biology 2019Quote: ... BMP4 and 6 were prepared by in vitro transcription (DIG RNA labeling kit; Roche Diagnostics). Plasmids to generate cRNA probe for Smad4 was gifted by Prof ...
-
STARCH SYNTHASE 4 is required for normal starch granule initiation in amyloplasts of wheat endospermbioRxiv - Plant Biology 2021Quote: ... Glucose was measured in the supernatant using the hexokinase/glucose-6-phosphate dehydrogenase assay (Roche), for calculation of starch content in glucose equivalents ...
-
bioRxiv - Cell Biology 2021Quote: ... plasmids were introduced into HEK293T cells using the FuGENE 6 transfection reagent (Roche Applied Science). Cells were selected with puromycin (1 μg/ml) ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfection of HEK-293 cells was performed with FuGene 6 transfection reagent (Roche, Mannheim, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... and the released glucose was assayed using the hexokinase/glucose-6-phosphate dehydrogenase assay (Roche). For mature grains ...
-
bioRxiv - Neuroscience 2023Quote: qPCR was performed on a QuantStudio 6 Flex using the SYBR Green Master mix (Roche). In all cases ...
-
bioRxiv - Cancer Biology 2019Quote: ... the cell pellets were resuspended in lysis buffer (25 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 % NP-40, 5 mM MgCl2, 5 % glycerol and protease inhibitor cocktail [Roche]) and incubated for 20 min at 4 °C with end-over-end rotation ...
-
bioRxiv - Plant Biology 2020Quote: ... 150 mM NaCl, 5 mM EDTA, 5 mM EGTA, 0.1% Triton X-100, 1 mM PMSF, 1x protease inhibitor cocktail [Roche] ...
-
bioRxiv - Cell Biology 2021Quote: ... resuspended in 10 ml buffer A (50 mM Tris pH 7.5, 150 mM NaCl, 10% glycerol, 5 mM MgCl2, 5 mM ATP, Roche cOmplete EDTA-free protease inhibitor catalog # 11872580001) ...
-
bioRxiv - Microbiology 2019Quote: ... pH 7.4, 150 mM NaCl, 5 mM EDTA, 5% glycerol, 1% Triton X-100, and 1x complete protease inhibitor [Roche]). Cleared lysates were then incubated with glutathione sepharose (GE healthcare ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.25 μl forward (5 μM, IDT) and 0.25 μl reverse primer (5 μM, IDT) and was analysed on a LC480 instrument (Roche).
-
bioRxiv - Cancer Biology 2021Quote: ... 0.25 μl forward (5 μM, IDT) and 0.25 μl reverse primer (5 μM, IDT) and was analyzed on a LC480 instrument (Roche).