Labshake search
Citations for Roche :
401 - 450 of 1907 citations for 6 chloro 5 methoxy 3 Pyridinecarboxylicacid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... and was subsequently digested with 3 mg/mL Collagenase/Dispase (Roche) in PBS (1X ...
-
bioRxiv - Neuroscience 2023Quote: ... with 3 mg/mL DNAse I grade II (Roche, Cat# 104159). The cell suspension was centrifuged at 1,300 rpm for 5 minutes with 7.5% BSA solution (Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... and 3 cOmpleteTM mini EDTA-free Protease Inhibitor cocktail tablets (Roche)) ...
-
bioRxiv - Immunology 2023Quote: ... Fat was digested enzymatically with 3 mg/ml collagenase/dispase (Roche) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... followed by overnight digestion with 3 U PNGase F (Roche diagnostics) at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Animals were injected with diazepam (3 mg/kg, Roche Pharmaceuticals, CH), gaboxadol (10 mg/kg ...
-
bioRxiv - Cell Biology 2023Quote: MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay (Roche) was performed following manufacturer’s indications ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 mM CaCl2 and protease inhibitor cocktail (CompleteTM EDTA-free, Roche), and homogenized by 10 strokes using Dounce device ...
-
bioRxiv - Immunology 2024Quote: ... in HEPES buffer containing Liberase Blendzyme 3 (70 mg/ml; Roche) and DNaseI (30 mg/ml ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Plant Biology 2020Quote: ... and proteins were extracted in protein extraction buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 % glycerol, 2 mM EDTA, 5 mM DTT, 1 × EDTA-free Complete Protease Inhibitor Cocktail [Roche, USA] ...
-
bioRxiv - Biochemistry 2022Quote: Trophozoite stage Hyp1-Nluc parasites at 1% parasitaemia were pelleted by centrifugation at 500g and lysed in 450x pellet volume hypotonic buffer (10 mM Tris-phosphate, 5 mM EDTA, 5 mM DTT, 1x complete protease inhibitor cocktail (Roche) pH 7.4 ...
-
bioRxiv - Immunology 2022Quote: ... Tissue pieces then were transferred to a 50-mL conical tube containing 5 ml of digestion medium #2 (RPMI without phenol red containing 5% of FCS, 25 µg/ml of Liberase (Roche), and 200 µg/ml of DNase I (Sigma)) ...
-
bioRxiv - Systems Biology 2019Quote: ... 1 mM EDTA) supplemented with phosphatase inhibitors (5 mM b-glycerophosphate, 5 mM NaF, 1 mM Na3VO4 and protease inhibitors (Roche cOmplete ULTRA Tablets ...
-
bioRxiv - Neuroscience 2019Quote: ... Striatum and ventral midbrain from injected and non-injected hemispheres were rapidly dissected and homogenized with 6 volumes of Triton lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 5% glycerol, 1% Triton-X100, 1 mM EDTA, 1X EDTA-free Complete protease inhibitor cocktail [Roche] and 1X phosphatase inhibitor cocktail 2 and 3 [Sigma]) ...
-
bioRxiv - Physiology 2021Quote: ... cDNA was diluted 1:10 or 1:5 and 5 μl or 2 μl was used with the Light Cycler Syber Green master mix (Roche), or AMPLIFY ME SG Universal Mix (Blirt) ...
-
bioRxiv - Neuroscience 2022Quote: ... pH 7.5, 150 mM NaCl, 5% glycerol, 1% Triton X-100, 1□mM EDTA, 1X Complete Mini protease inhibitor cocktail [Roche]). Tissues were disrupted using a mechanical homogenizer (IKA T10 basic ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mM KCl, 10mM MgCl2, 1 mM PMSF, 5 mM Na3VO4, 5 mM NaF, 1 mM TCEP, cOmplete Protease Inhibitor Cocktail, Roche) in 2 steps ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 –1 L of the crude lysates were treated with 5 mg/mL each of DNase I and RNAse (Roche) for one hour at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... uridine 5’-diphospho-N-acetyl-glucosamine (UDP-GlcNAc) and cytidine-5’-monophospho-N-acetylneuraminic acid (CMP-Neu5Ac) were obtained from Roche Diagnostics [UDP-Gal ...
-
bioRxiv - Biophysics 2023Quote: ... 5% d8-13C depleted glycerol, 1 mM EDTA, 5 ug/mL of aprotinin and leupeptin and 100 µg/mL Roche protease inhibitor cocktail ...
-
bioRxiv - Developmental Biology 2023Quote: ... 250 mM NaCl, 5 mM EDTA, 5 mM EGTA, 0.1% Nonidet P-40 and protease inhibitor cocktail from Roche, France), were then added to the mix and gently rotated at 4°C for 30 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% FBS and 0.1% Insulin-transferrin-selenium (Roche)[14] ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.5 % Triton-X and 5 % blocking reagent (Roche) and rabbit anti-GFP antibody (A11122 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM 2-mercaptoethanol) with protease inhibitors (Roche) and 300 U/L benzonase (Sigma) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgCl2 with protease inhibitors tablets (Roche) and DNAseI (Sigma) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgCl2 with protease inhibitors tablets (Roche) and DNAseI (Sigma) ...
-
bioRxiv - Immunology 2019Quote: ... 5 mg/kg diazepam (Valium10, Roche Farma SA) and 1 mg/kg atropine (B ...
-
bioRxiv - Genetics 2020Quote: ... using 5 µL 2x KAPA mix (Roche, #KK2602), 10 µL cDNA ...
-
bioRxiv - Biochemistry 2021Quote: ... and 5 µg of RNase A (Roche Diagnostics) were added per µg of sample ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM 2-Mercaptoethanol and protease inhibitor (Roche). The lysis proceeded by 3 passages in a French press cell at a pressure of 1500 psi ...
-
bioRxiv - Physiology 2021Quote: ... midazolam (5 μg/g; Roche, Grenzach-Wyhlen, Germany) and fentanyl (0.05 μg/g ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5 μl phosphatase inhibitor 10X (Roche, 04906837001). Protein extracts from MCF10A-ER-Src were obtained by incubating cell pellets in Lysis Buffer SDS-Free containing 1% protease inhibitors and 1% phosphatase inhibitors on ice for 30 min ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 mM DTT and proteinase inhibitor cocktail (Roche)) at 2ml/g ...
-
bioRxiv - Microbiology 2020Quote: ... 5% glycerol) containing protease inhibitors (Roche, Basel, Switzerland). Total cell lysates (25 μg ...
-
bioRxiv - Cell Biology 2022Quote: ... 10mM NaF) and complete protease inhibitors (5×; Roche). The detergent soluble supernatant fractions were immediately processed for SDS– PAGE and immunoblotting with antibodies.
-
bioRxiv - Molecular Biology 2019Quote: ... 5% glycerol) supplemented with protease inhibitor cocktail (Roche). Lysates were incubated with GFP-Trap magnetic agarose beads (Chromotek ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 μl SYBR Green PCR master mix (Roche) and ultrapure water up to 10 μl was used and analyzed using the LightCycler 480 System (Roche) ...
-
bioRxiv - Pathology 2021Quote: ... 5 μl of PCR DIG labelling mix (Roche), 3 μl template DNA ...
-
bioRxiv - Biochemistry 2019Quote: ... 5 U/mL rabbit pyruvate kinase (Roche Diagnostics), 8 U/mL lactate dehydrogenase (Sigma-Aldrich)) ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 mM DTT and 1X protease inhibitor (Roche). Loose chromatin was removed with 1% SDS prior to sonication on a Bioruptor™ (Diagenode) ...
-
bioRxiv - Genetics 2020Quote: ... 5 mM EDTA with protease inhibitor cocktail (Roche), incubated at 4 °C for 30 min followed by centrifugation at 14000 rpm for 30 min to collect the supernatant ...
-
bioRxiv - Immunology 2022Quote: ... including 5% Western Blocking Reagent Solution (#11921673001, Roche) overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mM EDTA with protease inhibitors (11697498001, Roche)) by sonication using TAITEC VP-5S sonicator (output ...
-
Dual and Opposing Roles for the Kinesin-2 Motor, KIF17, in Hedgehog-dependent Cerebellar DevelopmentbioRxiv - Developmental Biology 2022Quote: ... 5 mM EDTA] containing protease inhibitor (Roche, 11836153001) and 1 mM phenylmethylsulfonyl fluoride (PMSF ...
-
bioRxiv - Genetics 2022Quote: ... in 5% blocking solution (Roche, cat. no.11096176001) at room temperature overnight ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM DTT and 1x Protease inhibitor (Roche)) ...
-
bioRxiv - Genetics 2023Quote: ... and 5 µL 2x KAPA HiFi ReadyMix (Roche). The following indexing primers were used (X indicates the positions of the 8 bp indices):
-
bioRxiv - Genetics 2023Quote: ... 5 µL KAPA HiFi HotStart ReadyMix (KAPA Biosystems) and 1.8 µL H2O HyPure ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 U/mL deoxyribonuclease I (Roche 1010459001)) ...