Labshake search
Citations for Roche :
401 - 450 of 7626 citations for 6 Quinoxalinecarboxamide 1 2 3 4 tetrahydro 3 oxo 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’UTRs and 3’UTRs amplifications were performed using either Expand High Fidelity PCR System (Roche) or KAPA HiFi PCR system (KAPA Biosciences ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl of 10% SDS and 5 μl of 10 mg/ml Proteinase K (Roche, #31158) were added and incubated at 50 °C for 1 h ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...
-
bioRxiv - Immunology 2023Quote: ... ‘reverse’ 5’-GGGTACTTGATTTCATAGACTTTA-3’) were used in a qRT-PCR on a LightCycler 480 II (Roche). The data were analysed with LightCycler® 96 SW 1.1 (Roche) ...
-
bioRxiv - Immunology 2023Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated in digestion solution (3 mg/mL collagenase D [Roche] in DMEM/F-12 [Gibco]) for 45 min at 37 °C with intermittent vortex mixing to dislodge soft tissues ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were resuspended and washed twice in 3 ml Red Blood Cell Lysis Buffer (Roche) to remove any visible blood cells ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with siRNAs or plasmid DNAs using Dharmafect 4 (Dharmacon) or Fugene 6 (Roche Applied Sciences) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... and Hexokinase + Glucose-6-Phosphate dehydrogenase at dilution 1:200 (Roche), for 15 min at 25°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... at a ratio of 6:1 using lipofectamine (Roche, catalog #6365787001), following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... pellets were resuspended in 100 µL of lysis buffer (50 mM Tris pH 7.5, 1 mM EDTA, 3 mM DTT, 1X cOmplete protease inhibitor cocktail [SKU, 11836145001, Roche], 1.1 mM PMSF, and 1X Pepstatin A) and beaten on a bead-beater for 5 minutes at room temperature with 100 µL of acid-washed glass beads (cat ...
-
bioRxiv - Developmental Biology 2022Quote: ... sections were blocked with 10% HI-serum for 2 h and incubated overnight at 4°C with alkaline phosphatase-labeled sheep anti-dig antibody (11093274910, Roche; 1:2500). After washing ...
-
bioRxiv - Cell Biology 2020Quote: ... per sample was washed 3 times with cold 1X PBS and 2μg anti-GFP monoclonal antibody (Roche) per sample was conjugated with Dynabeads in 1ml cold PBS at 4°C for 4h ...
-
bioRxiv - Microbiology 2019Quote: ... and CO2 reverse primer (5′-TACCTTGTTACGACT-3′)53 with KAPA Lightcycler 480 mix (KAPA Biosystems Ltd., UK) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... 25µl of Red ANTI-FLAG M2 Affinity Gel from SIGMA ALDRICH (F2426) were washed 3 times with TBS (50mM TRIS pH 7.5,150mM NaCl and protease inhibitor tablets [Roche]) and then added to samples ...
-
bioRxiv - Microbiology 2022Quote: ... at 37 °C for 3 hours followed by 19 μg/sample of trypsin (Roche Cat. Nr. 11418025001) at 37 °C for 13 hours ...
-
bioRxiv - Genetics 2020Quote: Exon 3 of the MSH2 gene was PCR amplified using the Expand High Fidelity PCR kit (Roche) with the following conditions ...
-
bioRxiv - Immunology 2020Quote: ... gently mechanically disaggregated and resuspended in PBS 1x containing 3 mg/ml of collagenase D (Roche Diagnostics) plus 10 μg/ml of DNAse (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... The harvested molars were pooled and dissociated with 3 U/mL Collagenase P (COLLA◻RO, ROCHE) followed by incubation for 45◻minutes in a 37°C shaking water bath ...
-
bioRxiv - Genomics 2021Quote: Mice livers were perfused and dissociated into single cells using Liberase Blendzyme 3 recombinant collagenase (Roche Diagnostics) as previously described8 ...
-
bioRxiv - Neuroscience 2022Quote: ... R: 5’-GACCTGCAGGAGGATCGTAG −3’) was determined by qPCR using FastStart Essential DNA Green Master Mix (Roche, 06402712001) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... Chloroplast were lysed osmotically in buffer 3 (25mM HEPES-KOH, pH 8.0) containing cOmplete protease inhibitor (Roche) and either separated into soluble and pellet fraction by centrifugation for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 mM MgCl2; 0.1 % NP-40; 0.2 U/µl RNaseOUT; 0.32 M Sucrose; 1x protease inhibitor, Roche) and transferred to 2 ml Dounce tissue grinder (Sigma) ...
-
bioRxiv - Developmental Biology 2023Quote: ... R-5’-GGGACGCAGCAACTGACATT-3’) was assessed by RT-qPCR using SyBR Green solution on a LightCycler480 (Roche). The cDNAs of every single cell were purified using the DNA Clean & Concentrator Kit (Zymo ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 ng ds-cDNA was processed for library construction using KAPA Hyper Prep Kit (Kapa Biosystems #KK8504) according to the standard protocol except that a 15-min USER enzyme (BioLab # M5505L ...
-
bioRxiv - Systems Biology 2023Quote: ... 3 mM MgCl2 and 0.1% IGEPAL CA-630) supplemented with 0.2U/µl of RNAse Protector (Roche, Switzerland), was added to each sample ...
-
bioRxiv - Genomics 2023Quote: Mastermix 3 (IS-PCR) was freshly prepared and contained 12.5 μl Kapa HiFi Hotstart Readymix (2x, Roche), 0.25 μl IS PCR Primers (10 μM ...
-
bioRxiv - Bioengineering 2022Quote: A total of 3 µL of AAV was treated with 20 units of DNase I (Roche #04716728001) at 37°C for 45 min to remove residual DNA in vector samples ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 mM NaCl, 3 mM MgCl2, 0.5 mM spermidine, 0.2 mM spermine, 0.01% Triton-X, 1x Roche complete protease inhibitors ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were homogenized 3 x 30s at 7000 power in a MagnaLyzer® (Roche Diagnostics, Basel, Schweiz) and placed on ice for ∼1 minute between each homogenization ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell extracts were obtained by washing 3 × in PBS and either lysing for RNA (TriPure reagent, Roche) or protein extraction (50 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... 2 μg ml−1 DNaseI (Roche), and protease inhibitor cocktail (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: ... resuspended in SDS-PAGE loading buffer (50 mM TrisC1 pH 6.8, 2% SDS, 0.1% bromophenol blue, 10% glycerol, 4% β-mercaptoethanol, 1 mM PMSF, 1x Roche cOmplete protease inhibitor cocktail) and boiled for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... G355-5 cells were transfected with 1 to 6 µg DNA in 6 cm dishes using X-treameGENE 9 (Roche, Basel, Switzerland). The 293T/17 cell line was obtained from ATCC (CRL-11268 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5mM K4Fe(CN)6 and 1 mg/mL of X-gal (Roche) until precipitate was sufficient to visualize ...
-
bioRxiv - Biochemistry 2020Quote: ... 6 μM EF-Tu was pre-incubated with 1 mM GTP (Roche) in Reaction Buffer for 5 minutes at 37°C and then was supplemented with 4 μM Val-tRNAVal (all final concentrations) ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was extracted from 3 million HEK293T cells or 0.75 million primary neurons using TriPure reagent (Roche) and purified using RNeasy MinElute Cleanup Kit (Promega ...
-
bioRxiv - Neuroscience 2020Quote: ... Dissected hippocampi were dissolved in lysis buffer (1M Tris-Cl, pH 7.5; 6M NaCl; 10% SDS; 0.5M EDTA; Triton-X 100; Phosphatase Inhibitor #3, Roche, #05-892-970-001 ...
-
bioRxiv - Microbiology 2019Quote: Cells were lysed in RIPA buffer (50 mM Tris-HCl pH7.6, 150 mM NaCl, 3 mM MgCl2, 10% glycerol, 0.5% NP-40, cOmplete EDTA-free Protease Inhibitors [Roche]) and then clarified by centrifugation at 21,000 × g for 10 min at 4°C ...
-
bioRxiv - Biophysics 2020Quote: ... The 3′ end of the 1,882-nt DNA handle was labeled with dig-ddUTP using terminal transferase (Roche), and the 798-nt DNA handle of the transcript was functionalized with biotin on the 5′ end of the PCR primer ...
-
bioRxiv - Cell Biology 2022Quote: ... The sonicated sample was layered over 3 ml of S3 solution (0.88 M sucrose, 0.5 mM MgCl2, 1x Complete protease inhibitor cocktail (Roche)) in a new Falcon tube and centrifuged at 3000 × g for 10 min at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... The resuspended pellet was layered carefully over 3 ml of S2 solution (0.35 M sucrose, 0.5 mM MgCl2, 1x Complete protease inhibitor cocktail (Roche)) and centrifuged at 1430 × g for 5 min at 4°C ...
-
bioRxiv - Genomics 2022Quote: ... 5 µL of 20 mM siRNAs and 3 µL of X-tremeGENE HP DNA Transfection Reagent (Roche, #6366546001) were diluted in 200 µL Opti-MEM (Gibco ...
-
bioRxiv - Developmental Biology 2022Quote: ... Positive control embryos were incubated in polymerase chain reaction buffer containing 3 U/ml DNase I recombinant (Roche) for 1 h at 37°C before adding the TUNEL reaction mix ...
-
bioRxiv - Microbiology 2022Quote: ... purified GST-RomA was incubated with equal amounts of HIS6-LphD or HIS6-LphD Y392F in protein binding buffer (25 mM Tris pH 8.0, 140 mM NaCl, 3 mM KCl, 0.1% NP40 with protease inhibitors (ROCHE)) overnight at 4°C ...
-
bioRxiv - Genomics 2019Quote: ... the 5’ end of the Ppetra cDNA was determined with the 5’/3’ RACE kit 2nd generation (Roche). Reverse transcription was performed as recommended by the suppliers ...
-
bioRxiv - Genomics 2020Quote: ... The 2nd strand was synthesized using 2nd primer (5-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNGTGGTATCAACGCAGAGTAC -3) with KAPA HiFi HS mix (KAPA Biosystems). The double stranded cDNAs were amplified using Illumina adapter-specific primers and LongAmp Taq DNA polymerase (NEB) ...